Assessing the Efficacy of Oregano, Apple Cider Vinegar, and Citric Acid in Water as a Treatment for Spotty Liver Disease Caused by Campylobacter hepaticus in Challenged SPF Laying Hens Open Access

Spotty liver disease (SLD) is a reemerging disease affecting primarily brown table egg layers in the United Kingdom, Australia, Jordan, Germany, Costa Rica, and the United States (1,2,3,4,5,6). It also has been isolated from broiler breeders in Costa Rica and in the United States (5). The organism implicated in SLD, Campylobacter hepaticus, has been reported as the causative agent resulting in small white to yellowish multifocal gross lesions on the livers of infected birds that causes reduced egg production, reduced egg size, and increased mortality in laying hens. In the United States, egg producers and veterinarians have seen the disease in all types of layer breeds, not only brown layers; however, in other parts of the world, this disease is mostly seen in brown layer hens. The disease now seen with C. hepaticus is likely similar to a disease first described by Peckham in 1958 (7) as avian vibrionic hepatitis that was discussed in the early editions of Diseases of poultry (1972 and 1984). The disease seemed to disappear and may have been related to the gradual conversion to cage rearing of modern poultry systems (8).

In 2011, the reemergence of SLD was reported, but researchers were unable to determine the organism causing SLD in layer hens (9). Later in 2016, the organism implicated in the disease was identified as C. hepaticus (10). The reemergence of SLD suggests that the practice of cage-free and free-range rearing may be a contributing factor where the risk for fecal-oral transmission is greater (8).

Campylobacter hepaticus hepaticus is a Gram-negative organism that grows under microaerophilic conditions at 37–42 C and has an S-shaped cell morphology with a single bipolar flagella. The colony morphology is cream-colored and flat spreading and has a wet appearance on blood agar (10). The disease affects hens around peak production (26–32 wk of age) but has also been reported in birds as young as 25–26 wk of age (11). Of most significance is the emergence of C. hepaticus in primarily brown laying birds that are housed in free-range sheds, though reports in the midwestern and southern United States have also documented morbidity due to C. hepaticus in caged layers (2,3). To date, the strains of C. hepaticus implicated in disease in the United States appear to be highly similar to strains implicated in disease in the United Kingdom, Germany, and Australia, supporting the emergence of a new pathogen affecting the world’s egg laying hens (12,13). A limited number of published complete genome sequences of C. hepaticus are available in the United States (1,3,12,14) to help in identifying potential vaccine candidates. Mortality rates as a result of C. hepaticus there are currently unknown; however, based on studies from the United Kingdom and Australia, weekly mortality rates as high as 1%–5% have been reported with total mortality as high as 15% (9,15). Decreased egg production is a significant concern with losses in the range of 10%–25% being reported on some farms (8). Necropsy of diseased birds show characteristic white multifocal spots on the liver of 1–2 mm in diameter (Fig. 1D), splenomegaly with mottling, and fibrinous perihepatitis. However, birds can become infected with C. hepaticus and show mild gross spotty liver lesions or not show any lesions on necropsy (2,16).

SLD is a disease that may occur year-round (2), and further outbreaks within the same flock when birds are in peak production are possible (11). Once C. hepaticus is introduced into a layer flock, the organism causes disease and can persist for weeks after the initial outbreak potentially affecting subsequent flocks placed in the same house (13,17). One of the concerns for egg producers is the decrease in egg production and egg quality, which may continue over the life of the flock. However, with subclinical disease, affected birds may not show overt signs of disease, resulting in low overall mortality over the life of the flock (8). Anecdotal reports suggest that although birds are infected with C. hepaticus, not all birds will exhibit the typical spotty liver lesions on necropsy, an observation that was also supported by others (2,8). In challenge studies where layers were inoculated with C. hepaticus at a concentration of 10⁹ to 10¹⁰ cfu/bird, lesions were detected in nearly every bird, and they appeared to shed the organism in feces (18). This shedding route may account for the horizontal spread of SLD in poultry houses. Indeed, recent work by Gao et al. (19) suggests that scratch areas may be a risk factor for SLD in cage-free layer houses.

Researchers have noted that C. hepaticus may cause enteritis (9), can rapidly move from the intestines to the liver (16), and appears to be more invasive than other Campylobacter species. The organism is bile resistant (20) and has been found at higher levels in bile than in the liver (18). Despite these studies there is, however, limited information on the pathogenesis of C. hepaticus, and genome sequencing of C. hepaticus strains noted there was a reduced number of pathogenicity genes, particularly as it relates to virulence and iron metabolism (14,21). It is also not known how C. hepaticus spreads to different continents, as a potential source has not been identified. However, the disease appears to not only affect layer hens but also broiler breeders (5) and has been isolated from environmental samples outside the layer houses and from wildlife (2,17).

Currently, there are no approved treatments for SLD in organic flocks; however, companies may respond by acidifying the water with products such as apple cider vinegar or citric acid and/or treating with a nonantibiotic intervention such as oregano (2). Additionally, no commercial vaccines are available in the United States. In Australia, research with a C. hepaticus autogenous vaccine showed a degree of protection against SLD in a challenge study (22). In severe cases of disease, antimicrobials such as chlortetracycline (Aureomycin®) may be used in feed with zero-day egg withdrawal for conventionally raised birds. For SLD treatment in broiler breeders, chlortetracycline in the feed and neomycin or oxytetracycline in the drinking water have been used (23). Novel treatments such as isoquinoline alkaloids and biochar (a carbon substance) have been shown to induce partial protection and lower the load of C. hepaticus in laying hens affected by SLD (24,25).

Since the increase in demand for “no antibiotics ever” products and the implementation of the veterinary feed directive as an approach to limit the use of antibiotics in poultry, producers and veterinarians have explored alternatives to control diseases in chickens, especially in organic poultry production (26). Phytobiotics such as essential oils, oleoresins, botanicals, and herbs have been used to reduce pathogens in chickens, including Campylobacter spp. (27,28,29). The use of essential oils in chicken diets also has shown some potential to decrease the Campylobacter load (30,31). Other agents such as sorbic acid, benzoic acid, propionic acid, and acetic acid in the drinking water have also been explored (32). To date, the use of oregano as a control for C. hepaticus has not been evaluated, and currently there is no research elucidating the effect of treating hens with acidifiers in the water to control C. hepaticus. However, it is well known that antibiotic activity improves with a lower pH value, by reducing overall bacterial load (33). Therefore, this study aimed to develop a challenge and treatment model to assess the effect of oregano, apple cider vinegar, and citric acid as potential control measures for C. hepaticus in challenged birds. Analysis for clinical signs, gross lesion scores of the liver, mortality, histopathology lesion scores, and transmission of C. hepaticus to naïve exposed chickens were assessed. The organism’s presence was also determined using bacteriology and polymerase chain reaction (PCR) analysis of bile and liver tissue.

The C. hepaticus strain RBCL71delta along with three other isolates (RBCL76delta, RBCL81delta, and RBCL91delta) isolated from laying birds with SLD from Georgia were used to challenge chickens (12). These strains were isolated from brown layer hens from an organic pasture-raised layer operation showing gross spotty liver lesions later confirmed as SLD by culture and PCR. The strains were cultured on blood agar (tryptone soy agar with 5% sheep blood; (Remel, Lenexa, KS) at 37 C under microaerophilic conditions using gas packs (AnaeroPak MicroAero gas-generating sachets Mitsubishi, Japan) for 7 days, and colonies were picked into phosphate-buffered saline (PBS; MP Biomedicals, Solon, OH), and all four strains were mixed equally to generate an inoculum dose of approximately 10⁷ cfu/ml/bird. All challenged birds were orally gavaged three times with a fresh suspension on days 1, 4, and 7 of the trial. Using a sterile syringe and gavage needle to deliver 0.2 ml of the suspension into the crop.

One hundred and fifty-five specific-pathogen-free (SPF) white leghorn eggs were obtained from a commercial source (Charles River Laboratories Inc., Wilmington, MA) and incubated at 37.5 C and 55% relative humidity in a small-scale hatcher (Natureform Inc., Jacksonville, FL) at the Poultry Diagnostic and Research Center, University of Georgia, Athens, GA. Although this disease is mainly seen in brown layers, it has been seen in white layers in the United States. The choice of SPF chickens was to ensure they were free of C. hepaticus as well as other bacteria that may cause liver lesions. At 1 day of age, a total of 151 SPF chickens were tagged with an ID number and raised together in floor pens sharing the same cage-free environment but with no access to the outside. At 17 woa, three random nonchallenged birds were selected and euthanatized to collect bile and liver tissue and observe for the presence of SLD gross lesions to confirm that birds were free of C. hepaticus prior to challenge, and the livers were free of liver lesions before challenge. At 17 wk of age, 148 birds were randomly divided into five groups; 18 birds from each of four groups (n = 35: 30 hens and 5 roosters) were orally challenged with the C. hepaticus RBCL cocktail (12) and one negative control group (n = 4: two hens and two roosters). Although SLD is a disease seen mostly in layer hens, the roosters were added to see if they would be equally affected as layer hens. Only 51% (n = 18) of the population in each group except the negative control group were orally challenged with the C. hepaticus RBCL cocktail. Groups were placed in five separate colony houses with a minimum of 1–2 ft² of floor space/bird. A dose of 10⁷ cfu/ml/bird of the C. hepaticus cocktail was given on days 1, 4, and 7 by oral gavage as described above. The challenge days and intervals were chosen to mimic natural field exposure where birds likely receive multiple exposures, and because the layers were not at peak production, we challenged them three times to ensure reproduction of the disease. On day 9 of the trial, after the first challenge dose, six orally challenged chickens and six nonchallenged chickens per group were euthanatized to collect samples for bacterial culture and to record gross lesions on the liver. In addition, at 10 d postchallenge, three of the challenge groups were supplied one of the following treatments: oregano (water, organic hemicellulose extract, organic origanum oil, xanthan gum; 2.5 oz/gallon of stock solution [∼20 ml/L]; Legano Liquid, Ralco Nutrition, Marshall, MN), commercially available apple cider vinegar (12 oz/gallon of stock solution [∼94 ml/L]; White House Foods, Winchester, VA), and citric acid (C₆ H₈ O₇, organic acid; 1 oz/gallon of stock solution [∼8 ml/L]; Clear View Enterprises, Tontitown, AR) in the drinking water. Water treatments were given for 5 days and during those days water and feed intake was recorded. The length of time chosen for treatment was based on field experience and consultation with producers. On day 15 postchallenge, the water treatments were discontinued, and four of the challenged birds and four nonchallenged birds per group were euthanatized, samples were collected for culture, and gross lesions were recorded. On day 20 postchallenge, five challenged chickens and four naïve nonchallenge birds were euthanatized for sample collection. At day 27 postchallenge, all remaining birds were euthanatized, tissues were collected for culture, and gross lesions were recorded (Fig. 1; Table 1). The timing of subsequent necropsies was to evaluate disease progression. Over the duration of the study, clinical signs, mortality, feed intake, and water intake were recorded. Birds were checked twice daily for any clinical signs and mortality. All birds had ad libitum access to water and feed.

Bacterial culturing was performed from bile samples aseptically collected from the gall bladder at necropsy. All samples were logged and assigned an ID corresponding to the bird ID. For bile samples, a 30 µl volume of bile was plated directly on duplicate blood agar plates and streaked out with a 10 µl loop, allowed to soak into the agar and incubated at 37 C and 42 C under microaerophilic conditions for 7 days. Following incubation, all plates were inspected for colonies with typical Campylobacter morphology. and suspect isolates were selected for PCR analysis.

Suspect colonies of Campylobacter recovered from bile samples were picked and added to 50 µl of sterile water in a 200 µl tube. Then the deoxyribonucleic acid (DNA) was extracted using the boil prep method (heating the suspension to 100 C for 10 min followed by cooling to 10 C for 10 min) using an Eppendorf X50s thermocycler (Eppendorf, Hamburg, Germany). The suspension was then centrifuged to precipitate cellular debris, and the supernatant (containing DNA) was removed to a new tube for analysis. DNA extraction from liver tissue was performed using the protocol for DNA Purification from Tissues Using the DNEasy Power Soil Pro Kit (Qiagen, Hilden, Germany). Briefly, no more than 250 mg of liver tissue was cut into small pieces, and DNA was extracted using the beads, buffers, enzyme, and microcolumns of the kit.

Amplification of DNA targeting the glycerol kinase gene was carried out using primers G2F3, CAGGAGTTTTACCACAATTC, and G2R2, CAAGCTAAAACAGGTTTGG (18). PCR amplification was carried out in a 25 µl reaction consisting of water 1(8.725 µl), 10X Dream TAQ PCR buffer (2.5 µl), DNTPs (1.25 µl), primers (0.2 µl) Dream TAQ polymerase (0.125 µl; Dream TAQ, Life Sciences), and DNA (2 µl). Positive controls included C. hepaticus NCTC 13823 (HV10) as the positive control and water in place of DNA for the negative control. Amplification was carried out on an Eppendorf X50s thermocycler using the following parameters: 98 C for 1 min followed by 35 cycles of 98 C for 10 sec, 57 C for 30 sec, and 72 C for 30 sec with a final extension of 72 C for 10 min. All PCR products were subjected to gel electrophoresis on a 1.5% agarose gel (Lonza, Alpharetta, GA) in Tris acetic acid/EDTA buffer at 100 V for 60 min. Following electrophoresis, the gel was stained in 0.25% ethidium bromide solution for 20–30 min and PCR products (463 bp product) visualized under ultraviolet (UV) light using an imager (UVP-BioDock-It², Analytik Jena, Jena, Germany).

Clinical signs were based on lethargy, diarrhea, and ruffled feathers. Gross liver lesion scores were calculated for each bird. Briefly, the livers were scored on a scale of 0–3 based on gross lesions characterized by multifocal, small, round, white foci on the liver surface (Fig. 1). A score of (0) indicated no lesions observed, mild (1) < 20 spots, moderate (2) > 20 but < 60 spots, and severe (3) > 60 spots or too numerous to count. Mortality or any bird that was euthanatized due to severe C. hepaticus clinical signs or due to criteria set out in the institutional animal care and use committee (IACUC) protocol received a score of 3.

Liver, spleen, and gall bladder were collected at 9, 15, 20, and 27 days postchallenge (dpch) and fixed in 10% neutral phosphate-buffered formalin. All tissues were trimmed and embedded in paraffin wax to form blocks. Cut sections were stained with haematoxylin and eosin at the University of Georgia Poultry Diagnostic Research Center and read by Dr. Monique França. The total histopathologic scores were calculated for each bird at each time point. The histopathology score system was based on percentage of parenchyma affected, severity of inflammation in bile ducts, hepatocyte necrosis, and bile duct hyperplasia. Briefly, the scores were based on a scale of 0–4; a score of (0) indicated normal in which less than 5% of the parenchyma was affected, minimal (1) in which over 6% to 15% of the parenchyma was affected, mild (2) in which over 16% to 30% of the parenchyma was affected, moderate (3) with 31% to 45% of the parenchyma affected, and severe (4) in which over 45% of the parenchyma was affected (Fig. 2). A median histopathology liver lesion score was calculated for each treatment group.

All chicken experiments in this study were performed under the Animal Use Protocol A2022 03-014-A1 approved by the Animal Care and Use Committee (IACUC) under regulations of the Office of the Vice President for Research at the University of Georgia.

Analysis of the data was performed using the statistics software GraphPad Prism (34). The median for gross liver lesions and microscopic lesions among treatment groups was compared using the Kruskal-Wallis test, and Dunn's test was performed as a multiple comparison procedure. The level of significance was considered at P < 0.05. In this study, statistical analysis for treatment groups includes both challenge and naïve/contact chickens within the same group from 9 to 27 dpch as a total per group. No statistical analysis was performed for each individual necropsy day to the low number of birds in each analysis, which was not enough to assess a measurable effect.

All three birds euthanatized before bacterial challenge were negative for C. hepaticus via bile culture and PCR analysis of the liver tissue. For bile samples collected at 9, 15, 20 and 27 dpch, results are expressed as the total number of PCR positive liver samples from 9 to 27 days, and the bile was the only sample used for bacteriological analysis. Any bacterial culture from bile showing suspect C. hepaticus colonies was confirmed with colony PCR, and results are reported as culture PCR.

Microbiological analysis of C. hepaticus from the oregano-treated group showed 6/18 samples had characteristic C. hepaticus colonies on bile culture, and 6/18 were positive by colony PCR. For the citric acid treatment, 2/18 were PCR positive for colony PCR. The apple cider vinegar treatment resulted in 5/18 bile samples positive for C. hepaticus on culture, and 5/18 were positive by colony PCR. The positive control group that received only municipal water treatment had 5/18 samples harboring C. hepaticus on bacteriological analysis of the bile, and 5/18 samples were positive by colony PCR. As expected, the negative control group at day 27 had no growth of C. hepaticus on any of the four samples tested (Table 2).

Liver samples collected at 9, 15, 20, and 27 dpch were analyzed by PCR of extracted DNA. Results are expressed as total samples from day 0 to 27. PCR detection for C. hepaticus from the oregano, citric acid, apple cider vinegar, positive control, and negative control groups had 8/18, 16/18, 15/18, 16/18, and 0/4 birds that were positive (Table 2).

No clinical signs were observed in any of the groups, and no mortality occurred during the study. SLD gross lesions were observed in all treatment groups except the negative control. Birds in the oregano, citric acid, apple cider vinegar, and positive control group had mild lesions resembling SLD in 2/18, 3/18, 1/18, and 4/18 birds, respectively (Table 3; Fig. 1B). In addition, only the positive control group had 1/18 birds with moderate SLD lesions (Table 3; Fig. 1C). However, when both positive control challenge and naïve birds in the positive control groups were analyzed together from day 9 to 27 dpch (Fig. 3), no significant differences were seen in lesion scores, but more SLD lesions were observed in general in that group. Histopathology scores in challenged and naïve chickens were not significantly different among groups when analyzed together from 9 to 27 dpch (Fig. 4); however, histopathological lesions were greater at 20 dpch, while at 9, 15, and 27 dpch lesions were minimal (Table 4).

During the entire length of the study, all chickens appeared healthy, and feed consumption was estimated at ∼90 g of feed/bird/day and ∼160 ml of water/bird/day during treatment with oregano, citric acid, or apple cider vinegar. In addition, no differences were observed in the rate of feed or water consumption among the different groups of the study.

For the naïve contact chickens that were introduced on the same day as the challenge birds from day 0 to 27 postintroduction, there were no clinical signs or mortality in any bird. Bacteriology culture plates from bile for C. hepaticus from day 0–27 postintroduction showed that none of the birds in the oregano, citric acid, apple cider vinegar had characteristic C. hepaticus colonies on bacterial culture, but 2/17 birds in the positive control group had characteristic C. hepaticus colonies on bacterial culture (Table 2), which were confirmed by PCR. In addition, PCR analysis of DNA from the liver of birds in the oregano, citric acid, and apple cider vinegar, and positive control groups found 5/17, 11/17, 10/17, and 11/17 birds were positive. Results showed that only the positive control group had SLD gross lesions on naïve contact exposed chickens, in which 2/17 birds showed severe spotty liver lesions (Table 2; Fig. 1D).

The objective of this study was to develop a challenge and treatment model to assess the potential effects of oregano, apple cider vinegar, and citric acid as control measures for C. hepaticus in challenged birds. To the authors’ knowledge, this is the first such study to evaluate the use of commercially available organic treatments to treat or control C. hepaticus in the United States, and this is the first reported study where spotty liver lesions were successfully reproduced in challenged birds using U.S. C. hepaticus strains. However, this is not the first study where spotty liver lesions have been reproduced in a challenge model: researchers in Australia have successfully reproduced the disease (16,24). SLD appears to affect hens at peak production (11) and during hot and wet weather seasons (2); although in this study, C. hepaticus did not cause clinical signs after challenging birds at 17 wk of age, SLD lesions were, however, evident in tissues postchallenge. In an epidemiological study carried out in 2020, Phung et al. (11) found that C. hepaticus can infect hens during the rearing phase and before they start to lay eggs with outbreaks of SLD occurring primarily during peak production (28 to 32 wk of age), but SLD can also occur before or after the production cycle. In the current study, SLD was reproduced in chickens from 17 wk of age onwards. Also, in this study, a percentage of challenged birds had gross lesions resembling those attributed to SLD. As noted above, all treatment groups appeared to consume the same rate of feed and water during the entire length of the study with no differences in feed and/or water consumption.

When challenged birds and naïve nonchallenged birds were examined on necropsy, some birds in the oregano, citric acid, apple cider, and positive control groups had gross mild spotty liver lesions evident with 2/18, 3/18, 1/18, and 4/18 birds, respectively, positive, but only the positive control challenged group had 1/18 birds showing moderate gross spotty liver lesions. The liver lesions observed were not severe, and the low score could be attributed to the birds being treated just days prior to sample collection and with the treatment(s) likely slowing the development of disease. This is in contrast to the positive control groups where a higher number of chickens developed SLD lesions. In addition, it has been reported by other researchers that liver lesions appear to decrease or disappear within a couple of days of infection with C. hepaticus (16). Although the efficacy of the three treatments used in the current study has not previously been evaluated for C. hepaticus, some producers anecdotally report that the approaches assessed here help to reduce clinical signs of SLD in organic layer hens where antibiotics are not permitted. The reduced transmission of C. hepaticus to naïve layers could be related to the lower pH of water when supplemented with oregano, citric acid, or apple cider vinegar (33). However, novel treatments such as isoquinoline alkaloids and biochar have also been demonstrated to reduce SLD in layer hens (24,25). It is not well understood how fast infected hens with C. hepaticus die as clinical signs are often missed because the infected hens can die quickly. In this study, mortality before and after treatments was not observed in any of the treatment groups, even among birds challenged with a high C. hepaticus dose (10⁷ cfu) given three times over a period of 7 days. Nevertheless, the birds used in this study were housed under relatively comfortable conditions with lower stocking density and limited stress, which is not reflective of actual industry conditions. In flocks where SLD has been identified, additional stress factors have also been identified including bacterial or viral disease challenge, density, and heat stress (13). In addition, producers and field veterinarians have reported SLD in layer hens with high stocking density, reduced access to feed and water, behavior issues, and poor environmental conditions (Becerra, pers. comm.).

During this study, blood agar plates that had colonies characteristic of Campylobacter were confirmed by PCR targeting the glycerol kinase gene (18). Some Campylobacter species cannot be differentiated using culture plates alone; therefore, PCR must be run to confirm C. hepaticus in a culture and to differentiate it from other Campylobacter species, such as C. jejuni and C. coli. Also, research has shown that C. hepaticus can enter a viable but nonculturable state during stress (35), which can prolong the survival of C. hepaticus in the environment, making it difficult to isolate from environmental samples. In this study, a high number of collected bile samples did not show growth on culture; however, many of those negative culture samples tested positive for C. hepaticus by PCR analysis of the liver from all treatment groups. This observation suggests that C. hepaticus in bile could enter a viable but nonculturable state and may not be easy to culture. In addition, due to the slow growth rate of C. hepaticus on blood agar, other organisms can grow and outcompete it making it difficult to isolate C. hepaticus in the presence of high numbers of other non–C. hepaticus organisms contaminating the plates. This can be especially problematic for culture on blood agar, which is currently one of the few media capable of culturing C. hepaticus.

In the United States, free-range flocks are moved to the hen house between 15 and 17 wk of age, and they are allowed to free range outside the house around 24 wk of age. Peak production can start as early as 26 to 30 wk of age. Spotty liver disease is observed primarily in free-range hens that have access to the outdoors and are usually at peak production, which could indicate that a few hens can become infected as soon as they have access to free range outside, bringing the organism back to the house where it can spread to other layer hens. In this study, the theory of fecal-oral transmission for C. hepaticus is supported as challenged birds became infected and were able to transmit the organism likely horizontally to naïve nonchallenged birds placed in the same group. In addition, we were able to detect the organism in roosters, demonstrating that these birds could also play a role in transmission in breeder facilities. So, too, the challenge using a younger bird coming into lay shows they can be as vulnerable to infection as an older bird. A recent case report by Becerra et al. (2) showed that fecal samples collected from different parts of hen houses of flocks that tested positive for C. hepaticus were also PCR positive. Also, C. hepaticus was detected in all areas of the house and persisted for more than 10 week despite ongoing treatment with apple cider vinegar and oregano (2). These field experiences suggest that C. hepaticus–infected hens may not respond well to some of the organic treatments typically used by organic producers during an outbreak of SLD and that the organism can persist for long periods in a house.

It is not well known what infectious dose of C. hepaticus is required to cause disease in hens. Van et al. (16) was able to infect 26-wk-old hens and show gross lesions resembling SLD with relatively high doses of 1 × 10⁹ and 1 × 10¹⁰ cfu of C. hepaticus. In the present study, chickens were infected with 1 × 10⁷ cfu/ml/bird on three occasions to reflect repeated exposure events that likely occur in field settings. It was expected the challenge dose would result in some mortality and that many chickens would develop severe SLD lesions; however, there were no clinical signs evident and no mortality, and most of the gross SLD lesions observed on necropsy were mild. Severe SLD gross lesions in this study resembling gross SLD lesions typically seen in the field were observed at 20 dpch with severe gross lesions observed only in the naïve contact birds; however, a high number of birds were positive on PCR of liver tissue. The findings from our current study suggest that the dose required to develop gross lesions and clinical signs attributed to SLD could be extremely high and likely linked to other factors such as stress and environment or may also be linked to differences in the pathogenesis of C. hepaticus strains.

In conclusion, oregano, citric acid, and apple cider vinegar have a limited effect in reducing C. hepaticus in chickens affected by SLD, but bacteriological analysis found that the above treatments could potentially reduce the transmission of C. hepaticus to naïve chickens. Once chickens are infected with C. hepaticus, however, it could take up to 9 dpch for transmission to naïve chickens based on liver PCR analysis. Severe SLD gross lesions may take up to 20 dpch to appear; however, chickens can be infected with C. hepaticus and not show SLD gross lesions. Further research is warranted to assess the pathophysiology and the endemic status of C. hepaticus in flocks as it appears to be a reemerging disease in layers and broiler breeders in many countries. Since there are no approved treatments or commercial vaccines currently available for C. hepaticus, further research is necessary to determine the most effective treatment and prevention strategies for SLD in laying hens.

This work was funded by the Dean’s Office, College of Veterinary Medicine, University of Georgia.

DNA =

deoxyribonucleic acid;

dpch =

days postchallenge;

IACUC =

institutional animal care and use committee;

PBS =

phosphate-buffered saline;

PCR =

polymerase chain reaction;

PDRC =

Poultry Diagnostic and Research Center;

SLD =

spotty liver disease;

SPF =

specific pathogen free;

TAE =

Tris acetic acid EDTA buffer;

TSA =

tryptone soy agar;

UV =

ultraviolet light