Genetic Evidence Confirms the Presence of Pygmy Rabbits in Colorado

The pygmy rabbit Brachylagus idahoensis is a sagebrush-obligate species that occurs in the Great Basin and adjacent intermountain regions (Orr 1940; Green and Flinders 1980). The pygmy rabbit (Figure 1) is the only member of the genus Brachylagus, is the smallest rabbit in North America (and possibly the world), and is one of only two North American rabbits known to dig their own burrows. The International Union for Conservation of Nature considers the pygmy rabbit a species of least concern (IUCN 2013); however, concern about the status of pygmy rabbit populations in the United States has led to petitions to list the species under the Endangered Species Act (ESA 1973, as amended; USFWS 2008, 2010). Although range-wide federal protection under the Endangered Species Act was not supported, the pygmy rabbit is recognized as a species of conservation concern throughout its known range. The Bureau of Land Management and the U.S. Forest Service list the pygmy rabbit as a sensitive species. Additionally, the pygmy rabbit is considered a Species of Greatest Conservation Need in Idaho (IDFG 2005), Utah (UDWR 2005), and Wyoming (WGFD 2010); a Species of Special Concern in California (CNDDB 2011); a Species of Concern in Montana (MTNHP 2011); a Species of Conservation Priority in Nevada (WAPT 2013); and a Sensitive Species in Oregon (ODFW 2006). The Columbia Basin pygmy rabbit population, which is isolated from the rest of the species' range, is a state endangered species in Washington (WDFW 2011) and a federally endangered Distinct Population Segment under the Endangered Species Act (ESA 1973; USFWS 2003).

Concern about the population status of the pygmy rabbit is largely due to the rabbit's specific habitat requirements and limited distribution. Pygmy rabbits depend on tall, dense sagebrush Artemisia tridentata spp. and are restricted to areas where soils are deep enough to support their burrow systems (Orr 1940; Green 1978; Wilde 1978; Green and Flinders 1980; Weiss and Verts 1984). Despite an abundance of sagebrush in the Great Basin, areas that meet the habitat requirements for this species are patchily distributed, resulting in naturally fragmented populations of pygmy rabbits (Weiss and Verts 1984). However, fragmentation itself is not necessarily a limiting factor for pygmy rabbits because juveniles regularly disperse 1–3 km from natal areas and are capable of dispersing >12 km between habitat patches in sagebrush ecosystems (Estes-Zumpf and Rachlow 2009; Estes-Zumpf et al. 2010).

Pygmy rabbits have not previously been documented in Colorado, despite proximity to the species' range in Wyoming and the presence of potential sagebrush habitat (Figure 2). Northwestern Colorado contains large expanses of sagebrush vegetation, and pygmy rabbits have been documented close to the southwestern border of Wyoming. We present the first documentation of pygmy rabbits in Colorado. Although this represents a modest range expansion, the confirmed presence of this species of conservation concern in Colorado indicates that surveys focused on determining the extent of their occurrence in this new range state are warranted.

The Vermillion Bluffs are located in northwestern Colorado and range in elevation from approximately 2,100 to 2,470 m. The area is dominated by sagebrush steppe vegetation and is home to other sagebrush species such as the sage thrasher Oreoscoptes montanus and greater sage-grouse Centrocercus urophasianus. The Bureau of Land Management manages the area for multiple uses, including recreation, hunting, and oil and gas development.

We detected evidence of pygmy rabbits during a visit to the Vermillion Bluffs in early July 2010. The primary author has >6 y of experience working with pygmy rabbits in the field and recognized clusters of lagomorph pellets in the area as being diagnostic of pygmy rabbits. We then searched for additional evidence of pygmy rabbits (burrows and pellets) in the immediate vicinity by targeting areas of dense sagebrush, especially areas characterized by mima mounds (mounded microtopography of 3–10 m in diameter) that supported relatively large sagebrush shrubs (Tullis 1995). We collected samples of pellets from each pellet cluster (n  =  16) found and placed samples in individual plastic bags marked with the pellet cluster name and GPS location. We also recorded whether the pellets were located near burrows and whether larger pellets characteristic of adult cottontails Sylvilagus sp. also were present in the immediate area.

We analyzed pellet samples at the Laboratory for Ecological, Evolutionary, and Conservation Genetics at the University of Idaho for species identification via genetic analyses. Fecal pellet DNA is commonly used to identify species and even individual animals in a number of wildlife species (e.g., Paxinos et al. 1997; Farrell et al. 2000; Adams et al. 2003; Kovach et al. 2003; Dalén et al. 2004). We recently developed methods using fecal DNA to allow for rapid and accurate differentiation between five different North American lagomorph species (Adams et al. 2011). We designed this method specifically to allow identification of pygmy rabbits from pellet samples.

We extracted DNA from pellet samples using the QIAamp DNA Stool Mini Kit (Qiagen, Inc., Valencia, CA) in a laboratory dedicated to low-quality DNA samples. Cells were rinsed from each pellet sample in buffer ASL (Qiagen, Inc.) before proceeding with the standard protocol. We included a negative control in the extraction to monitor for possible contamination in extraction reagents. We determined species of origin for each pellet sample using a species-specific mitochondrial DNA (mtDNA) fragment analysis test (Table S1; Adams et al. 2011). We amplified extracted DNA using polymerase chain reaction (PCR) on an MJ Research PTC-225 DNA Engine Tetrad thermal cycler. The reaction mixture contained 1.2 µM of the RabCytb F primer, 0.04 µM of the Pygmy R primer, 0.6 µM of the MtnDes R primer, 0.25 µM of the BTJR R primer and 0.2 uM each of the ECott and WTJR reverse primers (Table S1), 1.1 mM MgCl2, 0.4 mM dNTPs, 1X Amplitaq gold PCR buffer, 0.5 U of Amplitaq gold polymerase, and 1.0 µL of DNA extract in a 10-µL reaction. The thermal cycler profile for this reaction was an initial denaturation step of 95°C for 10 min followed by 15 cycles of 94°C for 30 s, touchdown from 63 to 55.5°C for 30 s and 72°C for 1 min, followed by 30 cycles of an annealing temperature of 53°C. We visualized PCR products using a 3130xl DNA Sequencer (Applied Biosystems, Foster City, CA). Fragment sizes were scored using Genemapper 3.7 (Applied Biosystems). The expected fragment size for pygmy rabbits is 294 base pairs. We verified results from the fragment analysis through DNA sequencing of 225bp of the mitochondrial cytochrome b region. We amplified extracted DNA with the RabCytb F ATGACCAACATYCGTAAAAC and Pygmy R ACGTGCATATAGAGGCAGAC primers (PCR conditions above; Adams et al. 2011). We purified PCR products using ExoSAP-It (USB® Products, Cleveland, OH). We then sequenced PCR products using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Final sequences were purified further using the BigDye XTerminator® Purification Kit (Applied Biosystems). We analyzed sequencing reactions using a 3130xl DNA Sequencer (Applied Biosystems) and DNA Sequencing Analysis Software 5.2 (Applied Biosystems). We then performed a BLAST search of DNA sequences on the National Center for Biotechnology Information GenBank website (www.ncbi.nlm.nih.gov/genbank/) to match DNA sequences from pellet samples to species of origin.

We successfully extracted and amplified sufficient DNA from 7 of 16 pellet samples. The fragment analysis test developed by Adams et al. (2011) has 100% accuracy in assigning species of origin to samples that successfully amplify using PCR. All seven samples were identified as originating from pygmy rabbits based on fragment analysis. Subsequent sequencing reactions yielded genetic sequences for five of the seven samples (Table S2; GenBank accession numbers JQ043360–JQ043364). All sequences were identical and matched two known pygmy rabbit sequences (accession numbers AY29272 and U58930) in GenBank. The event value for each match was very low, which indicated there was a very low probability that the match was due to chance (Table S3). Thus, the GenBank BLAST search confirmed that the genetic sequences obtained from our pellet samples were from pygmy rabbits. As a result, we confirmed presence of pygmy rabbits at three different locations in the Vermillion Bluffs area of Colorado (Figure 2). Distances between locations ranged from 2.4 to 7.7 km, and based on sizes of the pellets, we concluded that the samples included pellets from both adult and juvenile pygmy rabbits.

Results of genetic analyses provide the first record of the pygmy rabbit in Colorado. Although no pygmy rabbits were observed during searches, species identification from pellets was confirmed using two types of genetic markers. Furthermore, characteristics of pellet clusters (i.e., small size and latrines surrounding burrow entrances) were diagnostic of pygmy rabbits (Sanchez et al. 2009). Our findings demonstrate the value in using genetic methods of species identification in tandem with field observations to confirm species presence, especially in areas where the species previously has not been documented. Because all pellet samples confirmed to originate from pygmy rabbits were relatively recent (estimated <2 mo old) based on pellet color and condition (Roberts 2001; Sanchez et al. 2009), evidence suggests current occupation of the area by pygmy rabbits during the time of surveys.

Density of pygmy rabbits in the search area around the Vermillion Bluffs appears to be low. Although we found a high density of pellets from rabbits, we suspect a majority of the pellets to be from cottontails based on their shape, size, and dispersed rather than clustered distribution. We only collected pellets for genetic analyses from clusters that were characteristic of pygmy rabbits. The high density of cottontail pellets in the region makes identification of pellets based solely on morphology challenging, especially for untrained observers. Furthermore, few burrows were observed in the search area (approximately 0.04/ha). At seven sites occupied by pygmy rabbits in Idaho, the density of burrow systems actively being used by rabbits ranged from 0.19 to 3.46/ha (Price and Rachlow 2011). Because pygmy rabbits are considered obligate burrowers, the low density of burrows (active or inactive) that we detected in the Vermillion Bluffs area also supports the contention that pygmy rabbit density is low in this area.

Documentation of pygmy rabbits in Colorado has both conservation and management implications. From a conservation standpoint, the species' range is larger than previously recognized. Although this study documents the presence of pygmy rabbits <20 km into Colorado, potential habitat extends farther south, east, and west (Figure 2). Searches conducted thus far in the Vermillion Bluffs area were opportunistic and of short duration, encompassing a relatively small area. Systematic surveys involving adequate time and effort by trained observers are needed to establish the distribution of this species in Colorado. Depending on the extent of the species distribution and the status of populations in Colorado, inclusion of a new range state could alleviate some concern about the persistence of this species. In addition, these results confirm that the pygmy rabbit occurs across a broader area than previously documented and suggest that other undocumented populations also might exist both within and outside of its current range.

Discovery of the pygmy rabbit in Colorado has management implications for both state and federal agencies. Given the conservation status of the pygmy rabbit in every state in which the species is known to occur, it is possible that the pygmy rabbit could be considered a species of conservation concern in Colorado. If so, the habitat needs of pygmy rabbits should be considered in land management planning by state and federal agencies, and potential impacts to their populations from activities (such as prescribed burns, sagebrush manipulation, hunting, and oil and gas development) should be evaluated. The likely low densities and restricted distribution of the species in Colorado suggest that assessment of the conservation status of the pygmy rabbit in Colorado is needed to inform land management and conservation strategies for this sagebrush-dependent species.

Please note: The Journal of Fish and Wildlife Management is not responsible for the content or functionality of any supplemental material. Queries should be directed to the corresponding author for the article.

Table S1. Primer sequences used for species-specific mitochondrial DNA fragment analysis test and DNA sequencing from Adams et al. (2011).

Found at DOI: http://dx.doi.org/10.3996/012013-JFWM-005R.S1 (16 KB DOCX)

Table S2. Raw DNA sequence data and GenBank accession numbers for successfully amplified pygmy rabbit pellet samples collected in the Vermillion Bluffs area of Colorado. Sequences were obtained using RabCytb F and Pygmy R primers (Adams et al. 2011).

Found at DOI: http://dx.doi.org/10.3996/012013-JFWM-005R.S2 (16 KB DOCX)

Table S3. Results from GenBank including matching accession numbers, the maximum identity percentage (Max ID %), and the expect value (E value). The expect value is the probability that sequences will match by chance.

Found at DOI: http://dx.doi.org/10.3996/012013-JFWM-005R.S3 (16 KB DOCX)

We thank Doug Keinath and Gary Beauvais for initial comments on this manuscript. The manuscript was further improved thanks to constructive comments from the Subject Editor and reviewers for the Journal of Fish and Wildlife Management.

Any use of trade, product or firm names is for descriptive purposes only and does not imply endorsement by the U.S. Government.