HELICOBACTER CETORUM INFECTION IN STRIPED DOLPHIN (STENELLA COERULEOALBA), ATLANTIC WHITE-SIDED DOLPHIN (LAGENORHYNCHUS ACUTUS), AND SHORT-BEAKED COMMON DOLPHIN (DELPHINUS DELPHUS) FROM THE SOUTHWEST COAST OF ENGLAND

The genus Helicobacter has expanded over recent years, and species have been isolated from a wide range of animals (Fox 2002). Helicobacter has been implicated in conditions including typhlitis or colitis and gastritis in several species of mammals, and specifically, gastritis, peptic ulcer disease, and cancer in humans (Marshall 2002). Helicobacter infection in cetaceans was first reported in 2000 when novel Helicobacter species were isolated from Atlantic white-sided dolphins (Lagenorhynchus acutus) and characterized by analysis of partial 16S rRNA gene sequence from a short-beaked common dolphin (Delphinus delphis) with multifocal lymphoplasmacytic gastritis found stranded in Massachusetts, USA (Harper et al. 2000). In 2002, a similar organism was isolated from three species of cetaceans in captivity in the US, a bottlenose dolphin (Tursiops truncatus) from Hawaii, a Pacific white-sided dolphin (Lagenorhynchus obliquidens) from Illinois, and a beluga whale (Delphinapterus leucas) from Connecticut. These isolates and two from Atlantic white-sided dolphins in 2000 were described as a new species, Helicobacter cetorum in 2002 (Harper et al. 2002). Evidence of infection by Helicobacter in cetaceans from European waters has not been previously described.

Since the first isolation of Helicobacter pylori from the gastric mucosa of humans (Marshall and Warren 1984), there have been numerous species of this genus characterized from the gastrointestinal tract of mammals and birds (Solnick and Schauer 2001). Since H. cetorum was first described, researchers, by applying PCR-based techniques, have reported Helicobacter spp. in cetaceans. Helicobacter sp. DNA was detected in the dental plaque of two captive bottlenose dolphins with gastritis in Argentina, suggesting that the oral cavity may be a reservoir of the bacterium; however, cultures were not attempted, and the species was not identified (Goldman et al. 2002). A Helicobacter species was also demonstrated using 16S rRNA PCR and sequence analysis in the gastric fluid of six captive bottlenose dolphins in Australia (Oxley et al. 2005). The sequences of both of these suggest they may represent more novel species, but again, no cultures were attempted. The detection of Helicobacter sp., by 16S rRNA PCR and DNA sequence analysis with a 98–99% identity to sequences from H. cetorum, was reported in the digestive tract of an Atlantic spotted dolphin (Stenella frontalis) that stranded on the Caribbean coast of Venezuela. The inflammation seen in the duodenal ampulla and pyloric stomach of this animal may have been associated with the presence of Helicobacter in these tissues (Suárez et al. 2010). Molecular evidence of Helicobacter spp. has also been demonstrated in gastric fluids from a captive killer whale (Orcinus orca), a false killer whale (Pseudorca crassidens), and one free-living Franciscana (Pontoporia blainvillei) in Argentina, using PCR and 16S rDNA sequence analysis, and although cultures were attempted from these animals, they were all negative (Goldman et al. 2011).

Two dolphins during 2008 and two dolphins during 2009 were submitted to the Animal Health and Veterinary Laboratory Agency Polwhele by the Cornwall Wildlife Trust Marine Strandings Network for routine postmortem examination using a standardized protocol for cetaceans (Jepson 2006) under the Cetacean Stranding Investigation Programme. These were an Atlantic white-sided dolphin, two short-beaked common dolphins (1 and 2), and a striped dolphin (Table 1).

In addition to routine capnophilic bacterial cultures from tissue sections of heart blood, lung, liver, kidney, and brain, distal small intestine from the Atlantic white-sided dolphin and proximal jejunum from common dolphin 1 were inoculated directly onto 5% sheep blood agar (Oxoid, Basingstoke, UK) and MacConkey agar (Oxoid); these were incubated at 37 C in a capnophilic atmosphere (10% CO₂) and examined daily for 7 days.

From the striped dolphin only, tissue sections from fundic stomach and duodenum were taken, and these were inoculated directly onto 5% sheep blood agar and MacConkey agar, incubated at 37 C in a capnophilic atmosphere, and examined daily for 7 days. Additional tissue sections of fundic stomach and duodenum from the striped dolphin were inoculated directly onto 5% sheep blood agar (Oxoid), incubated at 37 C in a microaerophilic atmosphere (10% CO₂, 5% O₂, 5% H₂, and 80% N₂) in gas jars containing CampyGen™ gas packs (Oxoid) and examined daily for 7 days. From common dolphin 2, in addition to routine cultures from tissue sections of the brain, cardiac ulcer tissue sections were inoculated onto 5% sheep blood agar and Helicobacter agar, modified (Becton Dickinson, Heidelberg, Germany), incubated at 37 C in a microaerophilic atmosphere in gas jars using CampyGen gas packs and examined daily for 7 days.

Bacterial isolates were examined using standardized methods for Gram stain, oxidase and catalase production, and other phenotypic tests, as described by Harper et al. (2002). Identification was confirmed by sequencing of virtually the entire 16S rRNA gene of the isolates equating to a 1,441-base pair (bp) fragment following amplification with the primer pair 5′ AGTTTGATCCTGGCTCAG 3′ and 5′ACGGCTACCTTGTTACGACTT 3′ directly from crude cell lysates, followed by a sequencing strategy described previously (Hunt et al. 2013). Sequences of 1,441 bp obtained from each of the four isolates have been deposited in the European Molecular Biology Laboratory database as follows: isolate 22/M98/7/08, accession No. FN565162; isolate 22/M47/10/08, accession No. FN565163; isolate 22/M111/7/09, accession No. FN565164; and isolate 22/M74/10/09, accession No. FN565165.

Tissues, including intestine (duodenum, proximal jejunum, and distal small intestine), fundic stomach, and cardiac stomach ulcers adjacent to where cultures were taken, were fixed in 10% neutral buffered formalin and then processed and stained with H&E and Warthin-Starry silver stain prior to microscopic examination.

At postmortem examination, all four dolphins were in poor body condition. The death of common dolphin 2 was due to meningoencepahlitis and arthritis of the atlanto-occipital joint associated with Brucella ceti infection (Davison et al. 2013). The cause of the death of the three remaining dolphins was starvation and hypothermia (Table 1). All four animals had gross lesions within the gastrointestinal tract.

Examination of the gastrointestinal tract of the Atlantic white-sided dolphin showed multifocal coalescing hemorrhages in the distal third of small intestine. All stomach chambers were empty with bile-stained fluid in fundic and pyloric stomach and small intestine. Culture from the distal third (jejunum) of the small intestine produced a profuse mixed growth of Actinobacillus delphinicola, an unidentified Mycoplasma or Ureaplasma species, and a gram-negative, curved rod resembling a Campylobacter or Helicobacter species after 36 hr. Histologic examination of the mucosa of the jejunum revealed no evidence of inflammation or infection, but this may have been masked in the mucosal layer by autolysis. Warthin-Starry silver-stained sections demonstrated foci of argyrophilic spiral bacteria in the mucosa.

Examination of the gastrointestinal tract of common dolphin 1 showed a number of ≤10 mm, hard nodules with caseous core and numerous coalescing hemorrhages in wall of the pyloric stomach. Proximal jejunum and duodenum contained frank blood. There was seaweed present in cardiac stomach. Cultures from the proximal small intestine produced a scant growth of a Gram-negative, curved rod resembling a Campylobacter or Helicobacter species after 72 hr. Histologic sections of pyloric stomach showed chronic verminous hemorrhagic gastritis characterized by focal hemorrhage in the submucosa and cellular submucosal infiltration cuffing the necrotic remains of a trematode parasite possibly Pholeter gastrophilus. Warthin-Starry silver stain did not demonstrate argyrophilic spiral bacteria in this section. Sections of intestine showed early autolysis of the epithelium and there was no evidence of cellular or vascular changes consistent with infection or inflammation. Warthin-Starry silver-stained sections did reveal some foci of argyrophilic spiral bacteria within the sections of jejeunm and duodenum.

Examination of the gastrointestinal tract of the striped dolphin showed widespread hemorrhages in pyloric stomach mucosa and mucosa of duodenum and distal small intestine associated with capillaries. All stomach chambers were empty. Bile stained fluid was present in the fundic and pyloric stomach and small intestine. Cultures of fundic stomach and duodenum produced a light growth of Vibrio alginolyticus after 24 hr and a light growth of a gram-negative, curved rod resembling a Campylobacter or Helicobacter species after 4 days incubation. Histology sections of the fundic stomach lesion were diffusely congested. Warthin-Starry silver-stained sections revealed foci of argyrophilic spiral bacteria in the mucosal region including gastric pits. The jejunum and duodenum sections showed marked congestion of the mucosa and submucosa. The outer mucosal epithelium was missing, possibly due to autolysis, but there were areas of hemorrhage within the inner mucosa consistent with acute enteritis. Warthin-Starry silver-stained sections did not demonstrate argyrophilic spiral bacteria in these sections.

Examination of the gastrointestinal tract of common dolphin 2 showed the following: coalescing superficial ulcers present in cardiac stomach mucosa; mucous and pale areas with gritty central foci in fundic stomach; and bile-stained fluid in the small intestine. Cultures of cardiac stomach ulcers from produced a gross mixture but with a predominant growth of A. delphinicola and a moderate growth of a gram-negative, curved rod resembling a Campylobacter or Helicobacter species after 4 days of incubation. Examination of the cardiac stomach lesion (a mucosal ulcer) showed granulating tissue, exhibiting some superficial necrosis, hemorrhage, thrombosis, and mixed (mainly neutrophilic) cellular infiltration. The intact cardiac stomach epithelium was mildly hyperplastic at the margin of the ulcer. Warthin-Starry silver-stained sections of the cardiac stomach revealed numerous argyrophilic spiral bacteria superficially within the ulcer. These findings were consistent with focal, subacute ulcerative gastritis associated with Helicobacter spp.

On subculture, all suspect Helicobacter or Campylobacter isolates did not grow aerobically or anaerobically, but good growth was achieved microaerophilically at 37 and 42 C but not at 25 C. All isolates produced catalase and oxidase, were motile, and rapidly hydrolyzed urea. Tests for indoxyl acetate hydrolysis, nitrate reduction, and alkaline phosphatase hydrolysis were negative. The isolates were resistant to nalidixic acid and sensitive to cephalothrin. These results are consistent with a phenotypic description of H. cetorum, as described by Harper et al. (2002). The isolates were tentatively identified as a Helicobacter species and sent for 16S rRNA sequencing. Comparison of the 16S rRNA sequence with online databases (NCBI 2014) showed top matches with entries for H. cetorum. Phylogenetic analysis was carried out following alignment of sequences with the top database matches consisting of entries for H. cetorum from North American studies, including the type strain (accession AF292378) and type strains of other closely related Helicobacter species, such as H. pylori and Helicobacter felis (Fig. 1). All four isolates described here clustered closely with H. cetorum entries differing by 4–18 bp from the type strain sequence. The most divergent isolate from common dolphin 2 shared an identical sequence with entry AF292377, previously described as divergent from other H. cetorum entries, although found to be phenotypically identical (Harper et al. 2002). Molecular evidence is consistent with the identification of these strains as H. cetorum, although there are no widely accepted species cutoff values, three of the four isolates were 99% identical to the type strain equal to or greater than criteria often used for species determination. The most divergent isolate described above from common dolphin 2 still had 98.6% sequence identity. In contrast, matches to the type strain of the next most closely related species, H. pylori, were <98% for all for isolates.

Evidence for pathogenicity of H. cetorum is so far limited to individuals of six species of cetacean: short-beaked common dolphin, bottlenose dolphin, beluga whale, Atlantic white-sided dolphin, Pacific white-sided dolphin, and Atlantic spotted dolphin (Harper et al. 2000; Harper et al. 2002; Suárez et al. 2010), all of which had gastritis. Therefore, it is possible that some of the more recently discovered species of Helicobacter not confirmed as H. cetorum are commensals or opportunistic pathogens, rather than primary pathogens. Helicobacter infections in humans are associated with subclinical to clinically significant inflammation of the stomach, with a risk of cancer in a smaller percentage of those infected. Development of disease is influenced by many factors, including the expression of Helicobacter virulence factors, such as H. pylori cagA, which is associated with a higher risk of atrophic gastritis and cancer in humans (Marshall 2002).

In terrestrial mammals, Helicobacter mustelae and Helicobacter acinonyx are reported as a cause of chronic gastritis in ferrets (Mustela putorius furo) and cheetahs (Acinonyx jubilatus; Fox et al. 1990; Eaton et al. 1993) Similarly, H. cetorum has been associated with gastric ulcers, lethargy, inappetence, and regurgitation in cetaceans (Harper et al. 2002). With the disadvantage of not being able to perform transmission studies, it is difficult to confirm that the Helicobacter species isolated from marine mammals are the primary cause of gastritis. However, isolation of H. cetorum from marine mammals with gastritis would suggest that it may play a role, as does H. pylori in humans.

None of the animals in this study had evidence of recent feeding. All four animals had gross pathologic lesions in the gastrointestinal tract. The Atlantic white-sided dolphin had multifocal coalescing hemorrhages present in the mucosa of the distal small intestine (jejunum), and both short-beaked common dolphins and the striped dolphin had mucosal hemorrhages in the pyloric stomach. Histologic examination of these lesions confirmed ulcerative gastritis in common dolphin 2 consistent with those described in Atlantic white-sided dolphins, short-beaked common dolphins, bottlenose dolphins, Pacific white-sided dolphins, and a beluga whale (Harper et al. 2002). Lesions consistent with acute enteritis in the striped dolphin were similar to those described in Atlantic spotted dolphins (Suárez et al. 2010); however, this may be due to the isolation of V. alginolyticus. Argyrophilic spiral bacteria were also demonstrated in Warthin-Starry silver-stained sections from various gastrointestinal sites in all four animals. Unfortunately performing electron microscopy on sections of the gastrointestinal tract on these animals to confirm features consistent with Helicobacter sp. as opposed to other spiral type bacteria was beyond the scope and finances of this study. The presence of autolysis in some histology sections may reflect a delay in processing the tissues rather than autolysis at the time of sampling. Nevertheless, and although other organisms were recovered in three of the four animals, H. cetorum was the only consistent isolate from the gastrointestinal tract in all four animals, from both stomach and intestine, even though isolation from the latter site would suggest possible passage from the stomach and may be an incidental finding. Although Helicobacter infection can be excluded as the cause of death of all these animals, it may have contributed to the poor condition of common dolphin 2.

These four cases are the first confirmed evidence, based on molecular and phenotypic characterization, of isolates consistent with the previously described H. cetorum infection in free-living cetaceans in European waters. Our confirmation of H. cetorum in a striped dolphin increases the host range of this organism. More work is necessary to determine the prevalence of Helicobacter spp., whether they are just commensal organisms, opportunistic pathogens, or primary pathogens, and their role in gastrointestinal disease in marine mammals.

We thank Cornwall Wildlife Trust Marine Strandings Network volunteers and British Divers Marine Life Rescue volunteers for the submission of carcasses. Postmortem investigation was carried out under the aegis of the UK Cetacean Strandings Investigation Programme, which is jointly funded by the Department for Environment Food and Rural Affairs and the UK Devolved Administrations. Molecular analysis was funded by an award from the AHVLA Seedcorn Programme (RD0016).