Abstract

In 2011, we conducted a field trial in rural West Virginia, USA to evaluate the safety and immunogenicity of a live, recombinant human adenovirus (AdRG1.3) rabies virus glycoprotein vaccine (Ontario Rabies Vaccine Bait; ONRAB) in wild raccoons (Procyon lotor) and striped skunks (Mephitis mephitis). We selected ONRAB for evaluation because of its effectiveness in raccoon rabies management in Ontario and Quebec, Canada, and significantly higher antibody prevalence rates in raccoons compared with a recombinant vaccinia-rabies glycoprotein (V-RG) vaccine, Raboral V-RG®, in US–Canada border studies. Raccoon rabies was enzootic and oral rabies vaccination (ORV) had never been used in the study area. We distributed 79,027 ONRAB baits at 75 baits/km2 mostly by fixed-wing aircraft along parallel flight lines at 750-m intervals. Antibody prevalence was significantly higher at 49.2% (n = 262) in raccoons after ONRAB was distributed than the 9.6% (n = 395) before ORV. This was the highest antibody prevalence observed in raccoons by US Department of Agriculture Wildlife Services for areas with similar management histories evaluated before and after an initial ORV campaign at 75 baits/km2 with Raboral V-RG. Tetracycline biomarker (TTCC) was significantly higher among antibody-positive raccoons after ONRAB baiting and was similar among raccoons before ORV had been conducted, an indication of vaccine-induced rabies virus–neutralizing antibody production following consumption of bait containing TTCC. Skunk sample size was inadequate to assess ONRAB effects. Safety and immunogenicity results supported replication of this field trial and led to a recommendation for expanded field trials in 2012 to evaluate safety and immunogenicity of ground-distributed ONRAB at 150 baits/km2 in residential and commercial habitats in Ohio, USA and aerially distributed ONRAB at 75 baits/km2 in rural habitats along US–Quebec border.

INTRODUCTION

Coordinated oral rabies vaccination (ORV) with a recombinant vaccinia-rabies glycoprotein (V-RG) vaccine Raboral V-RG® (Merial, A SANOFI Company, Athens, Georgia, USA) has resulted in canine rabies elimination in coyotes (Canis latrans; Fearneyhough et al. 1998; Sidwa et al. 2005), and the US was declared canine rabies free in 2008 (Velasco-Villa et al. 2008). Oral rabies vaccination has been successfully applied in gray foxes (Urocyon cinereoargenteus) in Texas, USA (Sidwa et al. 2005), with no reported cases since May 2009 (Blanton et al. 2011), until a reported case in a cow in May 2013 (E. Oertli pers. comm.). ORV has prevented appreciable spread of raccoon (Procyon lotor) rabies to the west in the US (Slate et al. 2009).

Although these accomplishments are important, the inability to eliminate raccoon rabies from high-risk corridors prompted the evaluation of vaccine baits potentially capable of producing population immunity levels necessary to achieve this goal (USDA 2010b). A live, recombinant human adenovirus–rabies glycoprotein vaccine (AdRG1.3; Charlton et al. 1992), designated Ontario Rabies Vaccine Bait (ONRAB; Artemis Technologies, Guelph, Ontario, Canada; Fig. 1), was selected on the basis of 1) its use along the US–Canada border without untoward events and success in reducing and eliminating raccoon rabies (Rosatte et al. 2009b; Mainguy et al. 2012); 2) lack of timely access to other vaccines for field testing; 3) absence of reported rabid striped skunks (Mephitis mephitis) infected with the raccoon rabies virus variant in Ontario since 2004 and Quebec since 2009 (D. Donovan and J. Mainguy pers. comm.), suggesting dependence on virus spillover from the raccoon reservoir; 4) published and unpublished ONRAB data from Canada (USDA 2008a; Rosatte et al. 2009a; Rees et al. 2011); 5) results of border studies comparing ONRAB and Raboral V-RG under similar environmental and rabies management conditions (Fehlner-Gardiner et al. 2012; Mainguy et al. 2013); and 6) effectiveness in controlling rabies in residual foci in skunks through high bait densities (300 baits/km2) and narrow flight lines (250 m; Rosatte et al. 2011). We summarize key safety and immunogenicity findings of this ONRAB trial in raccoons and skunks, the first study of this type in the US in >20 yr (Hanlon et al. 1998; Roscoe et al. 1998), and discuss management implications and recommendations.

Figure 1.

Ontario Rabies Vaccine Bait (ONRAB) distributed in the oral rabies vaccine field trial in West Virginia, USA, 2011. (Photo: Wildlife Services' Rabies Management Program Photo Library)

Figure 1.

Ontario Rabies Vaccine Bait (ONRAB) distributed in the oral rabies vaccine field trial in West Virginia, USA, 2011. (Photo: Wildlife Services' Rabies Management Program Photo Library)

MATERIALS AND METHODS

Study area

The 1,460 km2 field trial site in West Virginia, USA (37°44′N, 80°35′W) consisted of hardwood, mixed coniferous-hardwood, and evergreen forests (61%); livestock agriculture characterized by pasture/hay (23%); small towns (2%); and other habitats (14%; USDA 2011a; USGS 2014). Habitats were characterized by Strausbaugh and Core (1978) and Fleming et al. (2006). No ORV had been conducted in this study area, which was enzootic for raccoon rabies (Fig. 2).

Figure 2.

Raccoon (Procyon lotor) rabies virus variant (RRV) case history in West Virginia (WV), USA, 2007–11 within an 83-km radius of the center of the 2011 Ontario Rabies Vaccine Bait (ONRAB) oral rabies vaccination (ORV) zone (gray shading). Each dot represents a confirmed case of RRV in an animal, and the hatched area represents the 2011 vaccinia-rabies glycoprotein (V-RG) ORV zone.

Figure 2.

Raccoon (Procyon lotor) rabies virus variant (RRV) case history in West Virginia (WV), USA, 2007–11 within an 83-km radius of the center of the 2011 Ontario Rabies Vaccine Bait (ONRAB) oral rabies vaccination (ORV) zone (gray shading). Each dot represents a confirmed case of RRV in an animal, and the hatched area represents the 2011 vaccinia-rabies glycoprotein (V-RG) ORV zone.

Field trial design

The design included four 127-km2 sampling cells separated by a 5-km buffer (Fig. 3). An 11-km buffer was established from the western edge of the ONRAB sampling cells to the Raboral V-RG zone baited at 75 baits/km2 since 2001 (USDA 2005) to reduce the chance of confounded serologic results. A 5-km buffer was established from the sampling cell perimeters within the ONRAB baited area to reduce potential dilution effect from sampling raccoons with home ranges that extended into unbaited areas.

Figure 3.

Preselected random live-trapping points and locations of raccoon (Procyon lotor) and striped skunk (Mephitis mephitis) captures during pre– and post–oral rabies vaccination (ORV) sampling periods in the Ontario Rabies Vaccine Bait (ONRAB) field trial in West Virginia, USA, 2011. The hatched area represents the 2011 vaccinia-rabies glycoprotein (V-RG) ORV zone.

Figure 3.

Preselected random live-trapping points and locations of raccoon (Procyon lotor) and striped skunk (Mephitis mephitis) captures during pre– and post–oral rabies vaccination (ORV) sampling periods in the Ontario Rabies Vaccine Bait (ONRAB) field trial in West Virginia, USA, 2011. The hatched area represents the 2011 vaccinia-rabies glycoprotein (V-RG) ORV zone.

Oral rabies vaccine bait

The virus vector is well characterized (Graham and Prevec 1992). The Ultralite bait and live AdRG1.3, constituting ONRAB, have been described (Rosatte et al. 2009b). The matrix contained 100 mg of tetracycline hydrochloride (TTCC) biomarker (Rosatte et al. 2009b). There were 77,447 ONRAB baits aerially distributed along parallel flight lines at 750-m intervals at 75 baits/km2; 1,580 ONRAB baits were distributed at the same bait density by ground means near and within towns where aerial baiting was deemed unsafe. Baits had a warning label with a toll-free number (Fig. 1) to facilitate communication of potential bait and vaccine exposures to the West Virginia Department of Health and Human Resources (WVDHHR).

Animal capture, handling, and sampling

Biologic and serologic sampling

Animal sampling included live (cage) trapping (Tomahawk model 608, Tomahawk Live Trap LLC, Hazelhurst, Wisconsin, USA) and release of target species apparently not rabid based on behavior and gross examination. Rabies suspects were tested using a direct rapid immunohistochemistry test (Lembo et al. 2006), with rabies confirmation and virus variant typing by the Centers for Disease Control and Prevention (CDC). Nontarget species were released or collected for future histopathologic analysis. We set 150 live traps within 800 m of 25 preselected random points within sampling cells (Fig. 3). Traps were checked for 10 consecutive days. The same random points were used pre- and post-ORV sampling, 2–26 August 2011 and 21–31 October 2011, respectively.

Captured rabies reservoir species were sedated using an intramuscular injection of a 5∶1 ketamine∶xylazine (Kreeger 1999), to collect blood for rabies virus–neutralizing antibody (RVNA) determination, and first premolar tooth samples for age and biomarker analysis. Sex, reproductive status, and general condition were recorded. Serum samples were collected from blood centrifuged the day of capture and stored in labeled cryovials at −25 C to −70 C before shipment for analysis. Raccoons and skunks were released at their capture site after recovery from sedation.

Oral swab sampling

Oral swab samples were collected 1–6 days after ONRAB distribution through live trapping in the three spaces between the four sampling cells (Fig. 3). This scheme was used to reduce the chance of trap shyness among raccoons and skunks sampled post-ORV, which began 5 wk after bait distribution, approximating the minimum time for serologic response from ONRAB consumption (Brown et al. 2012).

RVNA determination

Labeled cryovials containing serum were shipped to CDC frozen on dry ice after pre- and post-ORV sampling. The rapid fluorescent focus inhibition test (Smith et al. 1973; CDC 2011) was used to determine RVNA titer. Samples with international units (IUs) ≥0.06 were considered RVNA positive.

AdRG1.3-neutralizing antibody determination

Frozen serum was shipped in labeled cryovials on dry ice to the Animal Health Diagnostic Center, Cornell University (Ithaca, New York, USA), to determine AdRG1.3 virus–neutralizing antibody (VNA) pre- and post-ORV sampling. The adenovirus virus neutralization assay followed standard procedures. Twofold serum dilutions (50 µL) in duplicate were mixed with 100–300, 50% tissue culture infectious doses of Ad-5 (VR-5, American Type Culture Collection [ATCC]) in a 50-µL volume. Mixtures were incubated for ≥1 hr at room temperature. A 100-µL volume of indicator cells (A549-ATCC) was added to each well, and the plates were placed in a CO2 incubator at 37 C for 6 days. Wells were scored for the presence or absence of typical Ad-5 cytopathology. Positive serum controls were an equine anti–Ad-5 (CDC, Atlanta, Georgia, USA) and a bovine anti–Ad-5.

Tetracycline biomarker and age determination

First premolars from raccoons and skunks were shipped to Matson's Laboratory (Milltown, Montana, USA) for TTCC and age determination. TTCC presence was determined with ultraviolet light at 100× magnification with a Leitz™ compound microscope (Leica Microsystems GmbH, Wetzlar, Germany; G. Matson pers. comm.). Ages were determined through the cementum method (Johnston et al. 1987). When ages could not be determined, individuals were assigned as juvenile or adult based primarily on body size and tooth characteristics (Grau et al. 1970).

ONRAB detection from oral swabs

An assay was developed for the AdRG1.3 vaccine in ONRAB according to Knowles et al. (2009a, b). A positive amplicon control (PAC) was generated using primers that flanked the assay target region (Ad5E3-F, GCGGACGGCTACGACTGAATGTTA; RVG-R, TTGTTTGGGCAGCTGAGGTGATGT). The PAC dilution amplification series showed the assay to be consistently sensitive to a level of detection of approximating 10 copies of viral DNA.

Oral Swab samples stored in universal viral transport tubes (Becton Dickinson, Sparks, Maryland, USA) were shipped for analysis to the Animal Health Diagnostic Center. Nucleic acid was purified from 175 µL of the medium using a MagMax Kit (ABI 1840). The ABI Path-ID mastermix (ABI, Loughborough, UK) was used for PCR amplification. Forward and reverse primers were used at a concentration of 400 nM and the probe was used at a concentration of 120 nM. Purified nucleic acid (4 µL) was used per reaction in a total volume of 25 µL. The quantitative (q)PCR reactions were run on an ABI 7500 thermocycler. Cycling conditions were 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 60 C for 1 min. In addition to the test samples, each set of reactions included two or more negative control wells, a positive extraction control well with AdRG1.3 vaccine diluted at 1×10−5 in transport medium, a negative extraction control consisting of transport medium only, and a PAC well with a calculated copy number of 100.

ONRAB vaccine-bait contact

A communications campaign to raise public awareness of the field trial, ORV and the risks of bait and vaccine contact, and the need to report potential vaccine exposures included a National Environmental Policy Act, Environmental Assessment 30-day public comment period (August–September 2011); talking points and a flow chart algorithm (Fig. 4) for responding to calls and categorizing vaccine vs. bait contacts (August–September 2011); a press release (September 2011); and a presentation on the field trial to the Greenbrier County Commission that included two television interviews (September 2011). We provided ONRAB information and safety guidelines, the material safety data sheet, and the ONRAB ground baiting protocol to Wildlife Services (WS) staff responsible for ground baiting (September 2011).

Figure 4.

Suggested standard operating procedure (SOP) for documenting and managing human contacts with Ontario Rabies Vaccine Baits (ONRABs) during field trial in West Virginia, USA, 2011. This is a suggested SOP. State and county health departments were not required to follow this SOP and may have altered the components to accommodate their program. This document was originally created for vaccinia-rabies glycoprotein (V-RG) oral rabies vaccination (ORV) distribution by Andrea McCollum and Brett Petersen in 2010 and modified by Richard Chipman for ONRAB in 2011. The content is based on information and SOPs from the US Department of Agriculture, Texas Department of State Health Services, and Ohio Department of Health. CDC Emergency Operations Center phone number: (770) 488-7100.

Figure 4.

Suggested standard operating procedure (SOP) for documenting and managing human contacts with Ontario Rabies Vaccine Baits (ONRABs) during field trial in West Virginia, USA, 2011. This is a suggested SOP. State and county health departments were not required to follow this SOP and may have altered the components to accommodate their program. This document was originally created for vaccinia-rabies glycoprotein (V-RG) oral rabies vaccination (ORV) distribution by Andrea McCollum and Brett Petersen in 2010 and modified by Richard Chipman for ONRAB in 2011. The content is based on information and SOPs from the US Department of Agriculture, Texas Department of State Health Services, and Ohio Department of Health. CDC Emergency Operations Center phone number: (770) 488-7100.

Statistical methods

Contingency tables and the Cochran-Mantel-Haenszel (CMH; Agresti 1996) test were used to determine whether the proportions of individuals pre- and post-ORV differed among sampling cells (1–4). The CMH test was used to determine whether age, sex, and antibody status were conditionally independent across sampling cells. McNemar's test for dependent samples was used to determine whether the proportion of antibody-positive individuals differed pre- and post-ORV. The CMH test was used to determine whether relationships existed between biomarking, serology, age, and sex. Among post-ORV samples, we explored differences by multiple logistic regression. Significance was set at P<0.05. All statistical analyses were conducted in SAS 2009 (SAS Institute Inc. 2009).

RESULTS

Target species biomarker and rabies serology

Antibody prevalence was 9.6% among raccoons (n = 395) before ONRAB baiting (Table 1) in the field trial area. Cell-to-cell proportion of antibody-positive raccoons during pre-ORV sampling did not differ relative to sex (CMH = 1.92, df = 1, P = 0.166) or age (CMH = 2.51, df = 1, P = 0.113). Cell-to-cell proportion of antibody-positive demographic classes ranged from 0% to 25% (Table 2). Adults comprised a greater proportion of individuals than juveniles.

Table 1.

Prevalence (%) of antibody to rabies virus by species sampled for pre– and post–Ontario Rabies Vaccine Bait (ONRAB) bait distribution in a field trial in West Virginia, USA, 2011.a

Prevalence (%) of antibody to rabies virus by species sampled for pre– and post–Ontario Rabies Vaccine Bait (ONRAB) bait distribution in a field trial in West Virginia, USA, 2011.a
Prevalence (%) of antibody to rabies virus by species sampled for pre– and post–Ontario Rabies Vaccine Bait (ONRAB) bait distribution in a field trial in West Virginia, USA, 2011.a
Table 2.

Rabies virus antibody prevalence (%) in raccoons (Procyon lotor) and corresponding sample size for pre– and post–Ontario Rabies Vaccine Bait distribution by sex and relative age and sampling cell in a field trial in West Virginia, USA, 2011.a

Rabies virus antibody prevalence (%) in raccoons (Procyon lotor) and corresponding sample size for pre– and post–Ontario Rabies Vaccine Bait distribution by sex and relative age and sampling cell in a field trial in West Virginia, USA, 2011.a
Rabies virus antibody prevalence (%) in raccoons (Procyon lotor) and corresponding sample size for pre– and post–Ontario Rabies Vaccine Bait distribution by sex and relative age and sampling cell in a field trial in West Virginia, USA, 2011.a

By contrast, 49.2% of raccoons (n = 262) sampled post-ORV were antibody positive (S = 102.68, df = 1, P<0.001). Cell-to-cell proportion of antibody-positive demographic classes ranged from 16% to 89% (Table 2) and did not differ by sex (CMH = 3.75, df = 1, P = 0.053) but did by age (CMH = 14.99, df = 1, P = 0.0001) due to a lower proportion of antibody-positive juveniles in cells 1 (χ2 = 6.28, df = 1, P = 0.012) and 2 (χ2 = 7.06, df = 1, P = 0.008).

TTCC presence was similar (P = 0.7303) at 10% (3/31) among raccoons duringpre-ORV but was significantly higher (P<0.0001) at 39.2% (48/122) among antibody-positive raccoons post-ORV (Table 3). No relationships were detected pre-ORV between biomarking and RVNA (P = 0.5300), age (P = 0.1716), or sex (P = 0.1657). However, differences were noted post-ORV relative to age and RVNA (P<0.0001), but not for sex (P = 0.6074).

Table 3.

Rabies virus–neutralizing antibody (RVNA) and tetracycline (TTCC) biomarker results for 341 and 248 raccoons (Procyon lotor) sampled before and after the distribution of Ontario Rabies Vaccine Bait in a West Virginia, USA, field trial in 2011.a

Rabies virus–neutralizing antibody (RVNA) and tetracycline (TTCC) biomarker results for 341 and 248 raccoons (Procyon lotor) sampled before and after the distribution of Ontario Rabies Vaccine Bait in a West Virginia, USA, field trial in 2011.a
Rabies virus–neutralizing antibody (RVNA) and tetracycline (TTCC) biomarker results for 341 and 248 raccoons (Procyon lotor) sampled before and after the distribution of Ontario Rabies Vaccine Bait in a West Virginia, USA, field trial in 2011.a

Only 27 raccoons marked during the pre-ORV period (6.8%) were recaptured post-ORV (10.3%). One raccoon recapture had detectable RVNA pre- (0.06 IU) and post-ORV (0.32 IU). This individual was TTCC negative. Eight of these 27 raccoons had RVNA post-ORV (including the one previously mentioned), but only two were biomarker positive. Four of six raccoons (n = 25, two were not tested for biomarker) that were biomarker positive post-ORV were antibody negative. Two of 23 raccoons with suitable pre-ORV tooth samples were TTCC positive.

One of 20 skunks had detectable RVNA pre-ORV; two of 28 had RVNA post-ORV (Table 1). No skunks were recaptured. Other species tested for RVNA represented incidental captures of rabies reservoir species in North America (Table 1; Blanton et al. 2011).

There was no evidence of adenovirus antibodies in 416 animals from the pre-ORV period. Seven of 296 (2.4%) samples demonstrated AdRG1.3 VNAs post-ORV: six raccoons and one skunk. Adenovirus antibodies were detected in 10 of 23 cattle serum samples collected within the study area prior to ONRAB distribution. Fewer (three of 23) cattle (different individuals from the pre-ORV sample) had VNA to adenovirus post-ORV.

ONRAB detection from oral swabs post-ORV

Oral swab samples were collected from 125 target and nontarget individuals live-trapped from days 1 to 6 post-ORV. Individual raccoons on days 2, 3, and 4 and a Virginia opossum (Didelphis virginianus) on day 4 had qPCR values <35, which are considered strong positives (Knowles et al. 2009a). An additional nine raccoons and four opossums with >35 qPCR values <40 were captured on days 1–4. No ONRAB was detected on days 5 or 6. Two of 15 raccoons and two of 12 opossums had >35 qPCR values <40 on day 1. These are not strong positives, but they represent the only animals sampled that could have had vaccine contact during day 1 after ONRAB distribution. It was not possible to determine the day of vaccine contact for the animals deemed positive from days 2–4.

ONRAB vaccine bait contact

No human or domestic animal bait or vaccine contacts were reported to the WVDHHR or WS during this field trial.

DISCUSSION

North American rabies management goals include elimination of rabies at its source in wildlife reservoirs (USDA 2008a, b). Raccoon rabies has not spread appreciably in the USA since ORV intervention began in the late 1990s, but contingency actions in the US and point infection control in Ontario (Rosatte et al. 2001), Quebec (Mainguy et al. 2012), and New Brunswick have been integrated into control to achieve this goal (Slate et al. 2009). Lack of progress toward elimination of raccoon rabies in the US has been attributed in part to relatively low population immunity with ORV strategies involving a single annual late summer aerial baiting with 750-m parallel flight line spacing at 75 baits/km2 with Raboral V-RG.

Antibody prevalence of 49.2% among raccoons (unadjusted for the 9.6% pre-ORV level) after ONRAB distribution was the highest WS has observed for a first baiting at 75 baits/km2 and 750-m flight line spacing where the RVNA baseline had been measured. Field trial replication was recommended and initiated in 2012 to determine whether raccoon population immunity becomes asymptotic after a second successive annual baiting, similar to the pattern observed for Raboral V-RG, but at antibody prevalence levels necessary to pursue raccoon rabies elimination more aggressively. Additionally, replicating this trial will allow for further investigation of differences noted in juvenile antibody prevalence across sampling cells. Population immunity levels approaching 70% have been cited as a general threshold for rabies elimination–based modeling (Anderson et al. 1981) and expertise (Coleman and Dye 1996); however, 60% (or between 50% and 60%) may be sufficient to break the rabies transmission cycle, with higher population immune responses increasing certainty of success (Thulke and Eisinger 2008).

Although this field trial was not specifically designed to compare ONRAB and Raboral V-RG, a mean antibody prevalence of 17.0±9.9% (SD; n = 11), uncorrected for mean RVNA of 4.9±4.8% (n = 13) was observed after a first baiting with Raboral V-RG in naïve areas under essentially the same initial ORV baiting characteristics during 2001–09 in Alabama, Florida, Georgia, Maine, North Carolina, Pennsylvania, Tennessee, and Virginia and similar raccoon density indices (USDA 2011c) as in this field trial, except in Florida (Tables 4, 5). Although comparative antibody prevalence samples were not collected in the adjacent Raboral V-RG zone in West Virginia post-ORV during 2011, in the 4 yr prior to this ONRAB field trial, RVNA prevalence ranged from 18.5% (n = 135; 2008) to 46% (n = 84; 2007). These represent RVNA levels for areas that have been subject to annual ORV campaigns at 75 baits/km2 with Raboral V-RG since 2001.

Table 4.

Rabies virus–neutralizing antibody prevalence before and after initial oral rabies vaccination (ORV) with Raboral V-RG, in areas never previously subjected to ORV. Raccoon population density indices associated with these regions are shown for post-ORV sampling periods (2001–09).

Rabies virus–neutralizing antibody prevalence before and after initial oral rabies vaccination (ORV) with Raboral V-RG, in areas never previously subjected to ORV. Raccoon population density indices associated with these regions are shown for post-ORV sampling periods (2001–09).
Rabies virus–neutralizing antibody prevalence before and after initial oral rabies vaccination (ORV) with Raboral V-RG, in areas never previously subjected to ORV. Raccoon population density indices associated with these regions are shown for post-ORV sampling periods (2001–09).

A RVNA prevalence of 9.6% in the pre-ORV sample was higher but fell within 1 SD of the mean for areas of similar status before ORV with Raboral V-RG (Table 4). Background RVNA is likely related in part to naturally acquired immunity from sublethal exposures (Bell et al. 1972; Botros et al. 1979) to raccoon rabies virus (Fig. 2) or bat rabies virus variants enzootic in the study area (Blanton et al. 2011). Although raccoon rabies was enzootic in the West Virginia field trial zone, previous studies have reported higher RVNA prevalence in raccoon populations in areas that were naïve to the raccoon rabies virus variant and ORV (McLean 1971; Ramey et al. 2008). Movement of orally vaccinated raccoons across the established buffers for this field trial from the nearby Raboral V-RG ORV zone (Fig. 3) cannot be completely ruled out as a potential contributing factor. There are no known wildlife rehabilitation facilities in the immediate area that could have released hand-inoculated raccoons as a source of RVNA pre-ORV.

The significant relationship between TTCC and RVNA adds confidence that antibody prevalence was, in large part, attributable to ONRAB bait consumption (Johnston and Voight 1982; Rupprecht et al. 1987; Rosatte et al. 2009b). That TTCC was not closer to unity than 48 of 122 for antibody-positive raccoons may be largely a function of using first premolar teeth for biomarker detection. Canine teeth and mandibular bone are superior tissues for TTCC biomarking (Linhart and Kennelly 1967; Algeo et al. 2013), but we collected first premolar teeth as a less intrusive procedure so that raccoons could be released after full recovery from sedation. Canine tooth sampling would have required euthanasia and eliminated the opportunity to obtain valuable biologic information in future field trials through recaptures.

Background sources could have contributed to the TTCC level of 48 of 122 RVNA-positive raccoons post-ORV. The most likely background TTCC sources may have included consumption of medicated feeds sometimes used for cattle production and nonspecific fluorescence that may be found naturally (Chopra and Roberts 2001). TTCC was detected in 28 of 341 (8%) pre-ORV (3/31 antibody-positive raccoons and 25/310 antibody-negative raccoons were biomarker positive pre-ORV) and 69 of 248 (28%) of post-ORV raccoons irrespective of RVNA status. However, there was significantly higher biomarker post-ORV irrespective of antibody status compared with pre-ORV. TTCC exposure through bait contact only (i.e., the raccoon failed to puncture the blister pack containing the vaccine) may account for a portion of TTCC-positive, antibody-negative raccoons post-ORV. Only one of 27 raccoons recaptured during post-ORV trapping that also had detectable RVNA pre-ORV had an elevated titer suggestive of an anamnestic response to ONRAB consumption, but this was not supported by TTCC marking.

Sample size was inadequate to evaluate the immune response of ONRAB in striped skunks. The four skunk captures during raccoon density indexing (Table 5) suggests low population densities. However, it may be possible to improve skunk capture rates in future trials using baits more attractive to skunks (Rosatte et al. 1992).

Table 5.

Raccoon (Procyon lotor) population density indices on the basis of 50 cage traps set for 10 consecutive nights and moved to cover a 3-km2 study area within the area that served as the Ontario Rabies Vaccine Bait field trial study area in West Virginia, USA, 2011.

Raccoon (Procyon lotor) population density indices on the basis of 50 cage traps set for 10 consecutive nights and moved to cover a 3-km2 study area within the area that served as the Ontario Rabies Vaccine Bait field trial study area in West Virginia, USA, 2011.
Raccoon (Procyon lotor) population density indices on the basis of 50 cage traps set for 10 consecutive nights and moved to cover a 3-km2 study area within the area that served as the Ontario Rabies Vaccine Bait field trial study area in West Virginia, USA, 2011.

There was no evidence of AdRG1.3 VNAs in target species pre-ORV. That only 2.4% (six raccoons and one skunk) of target species post-ORV had AdRG1.3 VNAs is likely a function of the virus vector being adapted to human hosts. Additional serologic surveys are planned for the replicate 2012 West Virginia trial to monitor AdRG1.3 VNA patterns. However, the presence of higher levels of adenovirus VNAs in cattle surveyed pre-ORV than post-ORV might be due to cross-reactivity to natural exposure to a ruminant adenovirus (10 known species in two genera), as there are no licensed ruminant adenovirus vaccines.

Absence of reported ONRAB bait contacts in humans was not surprising given that the 79,027 baits were distributed in predominantly rural areas. As field trials expand to include urban-suburban environments where contacts would be expected to increase, contact rates may be compared with those reported for Raboral V-RG (CDC 2013). About 120 million Raboral V-RG baits have been distributed from 1995 to 2011, with 1,464 human-bait contacts (i.e., picking up bait, finding bait in a yard, or removing bait from a pet dog's [Canis familiaris] mouth, feces, or vomit), equating to a human contact rate of 1/68,521 baits distributed (USDA 2011b; Roess et al. 2012), resulting in only two known adverse reactions (CDC 2009; USDA 2010a).

Between 2006 and 2011, ≥3.9 million ONRAB baits with an affixed phone label were distributed in Ontario with a call rate of 1/65,140 baits (64 calls) distributed. Fifteen calls involved possible vaccine contact (unconfirmed) as a result of handling a punctured bait or removing a bait from a dog's mouth, or a contact rate of 1/260,560 baits distributed. There were no reports of adverse events associated with reported human-bait contacts (Ontario Ministry of Natural Resources 2007, 2008, 2009, 2010, 2011). Between 2007 and 2009, only 16 reports of human exposure occurred in Quebec despite the distribution of almost 2 million baits (J. Mainguy unpubl. data). In 2010, ≥1 million ONRAB baits were distributed in Quebec, with no human bait contacts reported (Ontario Ministry of Natural Resources 2011).

From 1995 to 2008, 1,327 pet or other domestic animal Raboral V-RG bait contacts were documented, equating to a contact rate of 1/75,596 baits distributed (USDA 2011b). There were no reports of adverse reactions among the 261 pets with bait contacts, except eight dogs experienced vomiting or diarrhea after ingesting several baits. Animals that contact Raboral V-RG or ONRAB vaccine will most likely be immunized against rabies or receive a boost from a previous rabies vaccination.

Using a liberal interpretation of oral swab analysis, 17 (12 raccoons and five opossums) of 125 samples (14%) were positive for AdRG1.3 the first 4 days after ONRAB distribution. No AdRG1.3 was detected in wild-captured animals within the ONRAB field trial zone on days 5 or 6. Knowles et al. (2009b) reported excretion of the vaccine in the oral cavity at 0.8% of oral swabs and 6.8% of fecal specimens from experimental animals subjected to oral instillation. One skunk shed a small amount of virus in feces on day 14. Although fecal swab analysis was not conducted in this field trial, it will be considered in future ONRAB field trials. However, AdRG1.3 has been observed to remain stable through serial passage of infected lung tissue in the cotton rat (Sigmodon sp.), one of the few species susceptible to human adenovirus infection (Knowles et al. 2009a).

Knowles et al. (2009b) reported no adverse histologic effects for AdRG1.3 PCR-Southern Blot positives (18/1,280; 1.4%) and negative tissue samples obtained from experimental vaccinates or contact animals. Likewise, no histopathologic lesions were observed in a companion captive study for this field trial in the Virginia opossum, eastern cottontail rabbit (Sylvilagus floridanus), turkey (Meleagris gallopavo), eastern fox squirrel (Sciurus niger), and wood rat (Neotoma sp.) that received a 10× dose of AdRG1.3 per os (Fry et al. 2013). Although these animal safety findings support continuation of field trials, samples (pre-ORV, n = 290; post-ORV, n = 300) from wild-caught target and nontarget species collected from the study area will be analyzed and reported separately to expand the ONRAB animal safety database.

Results from this field trial led to a recommendation to initiate a safety and immunogenicity trial in Ohio in 2012 to evaluate ground baiting at 150 baits/km2 in urban-suburban environments where ORV with Raboral V-RG has occurred since 2004 at high bait densities, often twice annually. A field trial was also initiated in northern Vermont and New Hampshire and northeastern New York along the Quebec border in 2012. Site selection was based on the absence of raccoon rabies in Quebec since May 2009, with extensive enhanced surveillance and ONRAB ORV central to their elimination strategy.

Given the long-term goal of raccoon rabies elimination, the absence of cases is the ultimate measure of success. However, indices of bait consumption from biomarker and population immunity from RVNA represent key metrics of ORV performance for achieving success. Based on those indices in this first ONRAB field trial, positive results from comparative border studies between Raboral V-RG and ONRAB (Fehlner-Gardiner et al. 2012; Mainguy et al. 2013), and raccoon rabies control successes in Canada, successive year field trials with ONRAB should reveal whether immune levels necessary to eliminate raccoon rabies are attainable, recognizing that ORV strategies will need to be adapted to specific environments.

ACKNOWLEDGMENTS

We thank contributors at US Department of Agriculture Animal and Plant Health Inspection Service (USDA APHIS) Center for Veterinary Biologics; USDA APHIS Legislative and Public Affairs; USDA APHIS Policy and Program Development; Centers for Disease Control and Prevention; US Forest Service; West Virginia Departments of Agriculture and Health and Human Resources; West Virginia Division of Natural Resources; Greenbrier, Monroe, and Summers County Commissions; Animal Health Diagnostic Center, Cornell University College of Veterinary Medicine; Ontario Ministry of Natural Resources; Quebec Ministère des Ressources naturelles et de la Faune; Canadian Food Inspection Agency; Trent University; Artemis Technologies Inc.; and Dynamic Aviation Group Inc. for their input and collaborative spirit that helped make this field trial possible. Also, we thank Wildlife Services personnel in West Virginia and Virginia and at the Wildlife Services National Wildlife Research Center for extra effort and significant contributions to this field trial.

LITERATURE CITED

LITERATURE CITED
Agresti
A
.
1996
.
An introduction to categorical data analysis
.
John Wiley & Sons
,
Hoboken, New Jersey
,
290
pp.
Algeo
TP
,
Norhenberg
G
,
Hale
R
,
Montoney
A
,
Chipman
RB
,
Slate
D
.
2013
.
Oral rabies vaccination variation in tetracycline biomarking among Ohio raccoons
.
J Wildl Dis
49
:
332
337
.
Anderson
RM
,
Jackson
HC
,
May
RM
,
Smith
ADM
.
1981
.
Population dynamics of fox rabies in Europe
.
Nature
289
:
765
770
.
Bell
JF
,
Sancho
MI
,
Diaz
AM
,
Moore
GJ
.
1972
.
Nonfatal rabies in an enzootic area: Results of a survey and evaluation of techniques
.
Am J Epidemiol
95
:
190
198
.
Blanton
JD
,
Palmer
D
,
Dyer
J
,
Rupprecht
CE
.
2011
.
Rabies surveillance in the United States during 2010
.
J Am Vet Med Assoc
239
:
773
783
.
Botros
BA
,
Lewis
JC
,
Kerkor
M
.
1979
.
A study to evaluate nonfatal rabies in animals
.
J Trop Med Hyg
82
:
137
141
.
Brown
LJ
,
Rosatte
RC
,
Fehlner-Gardiner
C
,
Taylor
JS
,
Davies
JC
,
Donovan
D
.
2012
.
Immune response and protection in raccoons (Procyon lotor) following consumption of baits containing ONRAB®, a human adenovirus rabies glycoprotein recombinant vaccine
.
J Wildl Dis
48
:
1010
1020
.
Centers for Disease Control and Prevention (CDC)
.
2009
.
Human vaccinia infection after contact with a raccoon rabies vaccine bait—Pennsylvania, 2009
.
Morb Mortal Wkly Rep, http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5843a2.htm. Accessed February 2012
.
CDC
.
2011
.
CDC
.
2013
.
Human contacts with oral rabies vaccine baits distributed for wildlife rabies management—Ohio, 2012
.
Morb Mortal Wkly Rep
62
:
267
269
.
Charlton
KM
,
Artois
M
,
Prevec
L
,
Campbell
JB
,
Casey
GA
,
Wandeler
AI
,
Armstrong
J
.
1992
.
Oral rabies vaccination of skunks and foxes with a recombinant human adenovirus vaccine
.
Arch Virol
123
:
169
179
.
Chopra
I
,
Roberts
M
.
2001
.
Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance
.
Microbiol Mol Biol Rev
65
:
232
260
.
Coleman
PG
,
Dye
C
.
1996
.
Immunization coverage required to prevent dog rabies outbreaks
.
Vaccine
14
:
185
186
.
Fearneyhough
MG
,
Wilson
PJ
,
Clark
KA
,
Smith
DR
,
Johnston
DH
,
Hicks
BN
,
Moore
GM
.
1998
.
Results of an oral rabies vaccination program for coyotes
.
J Am Vet Med Assoc
212
:
498
502
.
Fehlner-Gardiner
C
,
Rudd
R
,
Donovan
D
,
Slate
D
,
Kempf
L
,
Badcock
J
.
2012
.
Comparison of ONRAB® and Raboral V-RG® oral rabies vaccine field performance in raccoons and striped skunks in New Brunswick, Canada, and Maine, USA
.
J Wildl Dis
48
:
157
167
.
Fleming
GP
,
Coulling
PP
,
Patterson
KD
,
Taverna
K
.
2006
.
The natural communities of Virginia: Classification of ecological community groups. Second approximation. Version 2.2
.
Virginia Department of Conservation and Recreation, Division of Natural Heritage
,
Richmond, Virginia
,
36
pp, .
Fry
TL
,
VanDalen
KK
,
Duncan Vercauteren
K
.
2013
.
The safety of ONRAB® in select non-target wildlife
.
Vaccine
31
:
3839
3842
.
Graham
FL
,
Prevec
L
.
1992
.
Adenovirus-based expression vectors and recombinant vaccines
.
Biotech
20
:
363
390
.
Grau
GA
,
Sanderson
GC
,
Rogers
JP
.
1970
.
Age determination of raccoons
.
J Wildl Manage
34
:
364
372
.
Hanlon
CA
,
Niezgoda
M
,
Hamir
AN
,
Schumacher
C
,
Koprowski
H
,
Rupprecht
CE
.
1998
.
First North American field release of a vaccinia-rabies glycoprotein recombinant virus
.
J Wildl Dis
34
:
228
239
.
Johnston
DH
,
Joachim
D
,
Bachmann
P
,
Kardong
K
,
Stewart
R
,
Dix
L
,
Strickland
M
,
Watt
I
.
1987
.
Aging furbearers using tooth structure and biomarkers
.
In:
Wild furbearer management and conservation in North America
,
Novak
M
,
Baker
J
,
Obbard
M
,
Malloch
B
,
editors
.
Ontario Trappers Association
,
North Bay, Ontario
, pp.
228
243
.
Johnston
DH
,
Voigt
DR
.
1982
.
A baiting system for the oral rabies vaccination of foxes and skunks
.
Comp Immunol Microbiol Infect Dis
5
:
185
186
.
Knowles
MK
,
Nadin-Davis
SA
,
Sheen
M
,
Rosatte
R
,
Mueller
R
,
Beresford
A
.
2009a
.
Safety studies on an adenovirus recombinant vaccine for rabies (AdRG1.3-ONRAB) in target and non-target species
.
Vaccine
27
:
6619
6626
.
Knowles
MK
,
Roberts
D
,
Craig
S
,
Sheen
M
,
Nadin-Davis
SA
,
Wandeler
AI
.
2009b
.
In vitro and in vivo genetic stability studies of a human adenovirus type 5 recombinant rabies glycoprotein vaccine (ONRAB)
.
Vaccine
27
:
2662
2668
.
Kreeger
TJ
.
1999
.
Handbook of wildlife chemical immobilization, 3rd Ed
.
Wildlife Pharmaceuticals
,
Fort Collins, Colorado
,
342
pp.
Lembo
T
,
Niezgoda
M
,
Velasco-Villa
A
,
Cleaveland
S
,
Ernest
E
,
Rupprecht
CE
.
2006
.
Evaluation of a direct, rapid immuno-histochemical test for rabies diagnosis
.
Emerg Infect Dis
12
:
310
313
.
Linhart
SB
,
Kenelly
JJ
.
1967
.
Fluorescent bone labeling of coyotes with demethylchlortetracycline
.
J Wildl Manage
31
:
317
321
.
Mainguy
J
,
Rees
EE
,
Canac-Marquis
P
,
Belanger
D
,
Fehlner-Gardiner
C
,
Seguin
G
,
Larrat
S
,
Lair
S
,
Landry
F
,
Cote
N
.
2012
.
Oral rabies vaccination of raccoons and striped skunks with ONRAB baits: Multiple factors influence field immunogenicity
.
J Wildl Dis
48
:
979
990
.
Mainguy
J
,
Fehlner-Gardiner
C
,
Slate
D
,
Rudd
RJ
.
2013
.
Oral rabies vaccination in raccoons: Comparison of ONRAB® and Raboral V-RG® vaccine-bait field performance in Quebec, Canada and Vermont, USA
.
J Wildl Dis
49
:
190
193
.
McLean
RG
.
1971
.
Rabies in raccoons in the southeastern United States
.
J Infect Dis
123
:
680
681
.
Ontario Ministry of Natural Resources
.
2007
.
Wildlife rabies control program annual report 2006–2007
.
Wildlife Research and Development Section.
47
pp.
[Available from Wildlife Research and Monitoring Section, Trent University, DNA Building, 2140 East Bank Drive, Peterborough, Ontario, Canada K9J 7B8.]
.
Ontario Ministry of Natural Resources
.
2008
.
Wildlife rabies control program annual report 2007–2008
.
Wildlife Research and Development Section.
30
pp.
[Available from Wildlife Research and Monitoring Section, Trent University, DNA Building, 2140 East Bank Drive, Peterborough, Ontario, Canada K9J 7B8.]
.
Ontario Ministry of Natural Resources
.
2009
.
Wildlife rabies control program annual report 2008–2009
.
Wildlife Research and Development Section.
34
pp.
[Available from Wildlife Research and Monitoring Section, Trent University, DNA Building, 2140 East Bank Drive, Peterborough, Ontario, Canada K9J 7B8.]
.
Ontario Ministry of Natural Resources
.
2010
.
Wildlife rabies control program annual report 2009–2010
.
Wildlife Research and Development Section.
24
pp.
[Available from Wildlife Research and Monitoring Section, Trent University, DNA Building, 2140 East Bank Drive, Peterborough, Ontario, Canada K9J 7B8.]
.
Ontario Ministry of Natural Resources
.
2011
.
Wildlife rabies control program annual report 2010–2011
.
Wildlife Research and Development Section.
24
pp.
[Available from Wildlife Research and Monitoring Section, Trent University, DNA Building, 2140 East Bank Drive, Peterborough, Ontario, Canada K9J 7B8.]
.
Ramey
PC
,
Blackwell
BF
,
Gates
RG
,
Slemons
RD
.
2008
.
Oral rabies vaccination of a northern Ohio raccoon population: Relevance of population density and prebait serology
.
J Wildl Dis
44
:
553
568
.
Rees
EE
,
Belanger
D
,
Lelievre
F
,
Cote
N
,
Lambert
L
.
2011
.
Targeted surveillance of raccoon rabies in Québec, Canada
.
J Wildl Manage
75
:
1406
1416
.
Roess
AA
,
Rea
N
,
Lederman
E
,
Dato
V
,
Chipman
R
,
Slate
D
,
Reynolds
MG
,
Damon
IK
,
Rupprecht
CE
.
2012
.
National surveillance for human and pet contact with oral rabies vaccine baits, 2001–2009
.
J Am Vet Med Assoc
240
:
163
168
.
Rosatte
RC
,
Power
MJ
,
MacInnes
CD
,
Campbell
JB
.
1992
.
Trap-vaccinate-release and oral rabies vaccination for rabies control in skunks, raccoons and foxes
.
J Wildl Dis
28
:
562
571
.
Rosatte
RC
,
Donovan
D
,
Allan
M
,
Howes
L
,
Silver
A
,
Bennett
K
,
MacInnes
C
,
Davies
C
,
Wandeler
A
,
Radford
B
.
2001
.
Emergency response to raccoon rabies introduction into Ontario
.
J Wildl Dis
37
:
265
279
.
Rosatte
RC
,
Donovan
D
,
Allan
M
,
Bruce
L
,
Buchanan
T
,
Sobey
K
,
Stevenson
B
,
Gibson
M
,
Macdonald
T
,
Whalen
M
,
et al.
2009a
.
The control of raccoon rabies in Ontario, Canada: Proactive and reactive tactics, 1994–2007
.
J Wildl Dis
45
:
772
784
.
Rosatte
RC
,
Donovan
D
,
Davies
JC
,
Allan
M
,
Bachman
P
,
Stevenson
B
,
Sobey
K
,
Brown
L
,
Silver
A
,
Bennett
K
,
et al.
2009b
.
Aerial distribution of ONRAB® baits as a tactic to control rabies in raccoons and striped skunks in Ontario, Canada
.
J Wildl Dis
45
:
363
374
.
Rosatte
RC
,
Donovan
D
,
Davies
JC
,
Brown
L
,
Allan
M
,
Von Zuben
V
,
Bachmann
P
,
Sobey
K
,
Silver
A
,
Bennett
K
,
et al.
2011
.
High-density baiting with ONRAB rabies vaccine baits to control arctic-variant rabies in striped skunks in Ontario, Canada
.
J Wildl Dis
47
:
459
465
.
Roscoe
DE
,
Holste
WC
,
Sorhage
FE
,
Campbell
C
,
Niezgoda
M
,
Buchannan
R
,
Diehl
D
,
Niu
HS
,
Rupprecht
CE
.
1998
.
Efficacy of an oral vaccinia-rabies glycoprotein recombinant vaccine in controlling epidemic raccoon rabies in New Jersey
.
J Wildl Dis
34
:
752
763
.
Rupprecht
CE
,
Dietzschold
B
,
Koprowski
H
,
Johnston
DH
.
1987
.
Development of an oral wildlife rabies vaccine: Immunization of raccoons by a vaccinia-rabies glycoprotein recombinant virus and preliminary field baiting trials
.
In:
Vaccines 87
,
Chanock
RM
,
Lerner
RA
,
Brown
F
,
Ginsberg
H
,
editors
.
Cold Spring Harbor Laboratory, Cold Spring Harbor
,
New York
, pp.
389
392
.
SAS Institute Inc
.
2009
.
Base SAS® 9.2 procedures guide
.
SAS Institute Inc.
,
Cary, North Carolina
,
1680
pp.
Sidwa
TJ
,
Wilson
PJ
,
Moore
GM
,
Oertli
EO
,
Hicks
BN
,
Rohde
RE
,
Johnston
DH
.
2005
.
Evaluation of oral rabies vaccination programs for control of rabies epizootics in coyotes and gray foxes
.
J Am Vet Med Assoc
227
:
785
792
.
Slate
D
,
Algeo
TP
,
Nelson
KM
,
Chipman
RB
,
Donovan
D
,
Blanton
JD
,
Niezgoda
M
,
Rupprecht
CE
.
2009
.
Oral rabies vaccination in North America: Opportunities, complexities, and challenges
.
PLoS Negl Trop Dis
3
:
e549
.
Smith
JS
,
Yager
PA
,
Baer
GM
.
1973
.
A rapid reproducible test for determining rabies virus neutralizing antibody
.
Bull W H O
48
:
535
541
.
Strausbaugh
PD
,
Core
EL
.
1978
.
Flora of West Virginia, 2nd Ed
.
Seneca Books Inc.
,
Grantsville, West Virginia
,
1079
pp.
Thulke
HH
,
Eisinger
D
.
2008
.
The strength of 70%: Revision of a standard threshold of rabies control
.
Dev Biol
131
:
291
298
.
US Department of Agriculture (USDA)
.
2005
.
Cooperative rabies management program national report: 2005
.
USDA-APHIS Wildlife Services
,
Concord, New Hampshire
, .
USDA
.
2008a
.
North American rabies management plan,
. .
USDA
.
2008b
.
U.S. national plan for wildlife rabies management (2008–2012)
.
(Strategies revised: March 30–April 1, 2010, National Rabies Management Team Meeting, Nashville, Tennessee.) Washington, DC, 42 pp. [Available from USDA, APHIS, Wildlife Services, 4700 River Road, Riverdale, Maryland 20737-1234.]
.
USDA
.
2010a
.
Environmental Assessment (EA) and decision/finding of no significant impact (FONSI)—Oral vaccination to control specific rabies virus variants in raccoons, gray foxes, and coyotes in the United States
.
USDA Animal and Plant Health Inspection Service, Washington, DC, 75 FR 10, January 15, 2010.
pp.
2480
2481
.
USDA
.
2010b
.
Assessment of APHIS Wildlife Services' National Rabies Management Plan
.
PAA-10-04.
51
pp.
[Available from USDA, APHIS, Wildlife Services, 4700 River Road, Riverdale, Maryland 20737-1234.]
.
USDA
.
2011a
.
Environmental Assessment (EA) and decision/finding of no significant impact (FONSI)—Field trial of an experimental rabies vaccine, human adenovirus type 5 vector in West Virginia,
.
USDA
.
2011b
.
Monitoring Report—Calendar Year 2008—for Environmental Assessment—Oral vaccination to control specific rabies virus variants in raccoons, gray foxes, and coyotes in the United States
.
[Available from USDA, APHIS, Wildlife Services, 4700 River Road, Riverdale, Maryland 20737-1234.]
.
USDA
.
2011c
.
Density index to raccoon population abundance and structure (Internal protocol)
,
7
pp.
[Available from USDA, APHIS, Wildlife Services, 59 Chenell Dr., Concord, New Hampshire 03301.]
.
US Geological Survey (USGS)
.
2014
.
Landsat,
http://landsat.usgs.gov/. Accessed January 2014
.
Velasco-Villa
A
,
Reeder
SA
,
Orciari
LA
,
Yager
PA
,
Franka
R
,
Blanton
JD
,
Zuckero
L
,
Hunt
P
,
Oertli
EH
,
Robinson
LE
,
Rupprecht
CE
.
2008
.
Enzootic rabies elimination from dogs and reemergence in wild terrestrial carnivores, United States
.
Emerg Infect Dis
14
:
1849
1854
.