Abstract

Hemochromatosis (iron storage disease) has been reported in diverse mammals including bottlenose dolphins (Tursiops truncatus). The primary cause of excessive iron storage in humans is hereditary hemochromatosis. Most human hereditary hemochromatosis cases (up to 90%) are caused by a point mutation in the hfe gene, resulting in a C282Y substitution leading to iron accumulation. To evaluate the possibility of a hereditary hemochromatosis-like genetic predisposition in dolphins, we sequenced the bottlenose dolphin hfe gene, using reverse transcriptase–PCR and hfe primers designed from the dolphin genome, from liver of affected and healthy control dolphins. Sample size included two case animals and five control animals. Although isotype diversity was evident, no coding differences were identified in the hfe gene between any of the animals examined. Because our sample size was small, we cannot exclude the possibility that hemochromatosis in dolphins is due to a coding mutation in the hfe gene. Other potential causes of hemochromatosis, including mutations in different genes, diet, primary liver disease, and insulin resistance, should be evaluated.

Iron storage disease, or hemochromatosis, has been reported in various mammalian species, including bats, primates, rhinoceroses, and marine mammals (Clauss and Paglia 2012). Etiologies of nonhuman mammalian hemochromatosis such as diet, environmental, and genetic have been suspected but not confirmed. Bottlenose dolphins (Tursiops truncatus) are susceptible to hemochromatosis, evidenced by high serum iron that progresses with age, excessive hepatic hemosiderin, high transferrin saturation, and response to phlebotomy (Venn-Watson et al. 2008; Johnson et al. 2009). In one managed collection, 67% of dolphins had mild to moderate hepatic hemosiderin at time of death, and 91.7% of those dolphins had hemosiderin in Kupffer cells (Venn-Watson et al. 2012). Compared to healthy controls, dolphins with hemochromatosis were more likely to have high liver aminotransferases, chronic hypercholesterolemia, chronic inflammation, and 2-hr postprandial hyperinsulinemia (Venn-Watson et al. 2008, 2011). The cause of hemochromatosis in dolphins has not been determined.

In humans, the most common cause of excessive iron accumulation is hereditary hemochromatosis. Approximately 90% of cases result from a point mutation in the hfe gene, causing a C282Y substitution (Camaschella and Strati 2010). Hepatocytes produce HFE, which is involved in regulation of iron absorption and homeostasis. HFE is a major histocompatibility complex (MHC) class 1–like protein that interacts with transferrin receptor 2 (TfR2) on hepatocyte cell surfaces (Martins et al. 2011). Increased plasma iron levels are sensed by the HFE-TfR2 complex, upregulating hepcidin expression. Hepcidin causes duodenal enterocytes to prevent iron transportation into the plasma. The C282Y mutation disrupts a disulfide bond required for binding to β2-microglobulin, preventing the processing and transport of HFE to the hepatocyte surface so that the HFE-transferrin iron-sensing unit cannot form to signal the expression of hepcidin (Pietrangelo 2010).

Our objectives were to isolate and sequence the hfe gene from bottlenose dolphins and compare the sequence between animals with hemochromatosis and healthy controls. This was a blinded study in which the identities of case and control animals were revealed following the completion of the hfe gene analysis.

Two case animals were included, in which the animals had mean serum iron levels >320 µL/dL and histopathology documenting hepatic hemosiderosis or hemochromatosis. Five control animals were included, in which the mean/median serum iron levels were consistently <240 µL/dL and histopathology did not report hepatic hemosiderosis or hemochromatosis. Serum iron levels were based on reference ranges for this managed dolphin collection (Venn-Watson et al. 2007). Ultrasound-guided liver biopsy was performed on one live animal; the remaining samples were obtained during necropsy. A section of each sample was submitted for histopathology; the remainder was stored at −80 C.

Total RNA was extracted from each individual liver sample using a Roche High Pure RNA Tissue Kit (kit 12033674001, Roche Applied Science, Indianapolis, Indiana, USA). The dolphin hfe gene was identified using the human HFE variant 1 (accession number NM_000410) against the dolphin genome (GenBank accession number ABRN00000000) using TBLASTN (Altschul et al. 1997). Primers (Table 1) were designed for the amplification of dolphin hfe based on the identified sequences. The dolphin hfe gene was amplified using the primers TtHFE F2 (5′ GGCCGGCGCTTCTCCTCCTGAT), of which the 3′ end aligns 16 nucleotides past the start codon, and TtHFE R2 (5′ GTAGGTGTATGGAGTCTGAGGTGATGCA), which aligns downstream of the stop codon. Amplifications were performed using the Qiagen OneStep RT-PCR Kit (Qiagen, Valencia, California, USA). The amplification settings were reverse transcription at 50 C for 30 min; 95 C for 15 min; 40 cycles of 94 C for 1 min, 60 C for 1 min, and 72 C for 1 min; and a final elongation step at 72 C for 15 min.

Table 1.

Primer sequences used for isolation and sequencing of the bottlenose dolphin (Tursiops truncatus) hfe gene.

Primer sequences used for isolation and sequencing of the bottlenose dolphin (Tursiops truncatus) hfe gene.
Primer sequences used for isolation and sequencing of the bottlenose dolphin (Tursiops truncatus) hfe gene.

The PCR products were run in agarose gels and bands were cut and extracted using the Qiaquick gel extraction kit (Qiagen). Purified PCR products were cloned into a bacterial vector and transfected into Escherichia coli using the Qiagen PCR Cloning Plus Kit. Up to 10 clones per sample were selected. The plasmids were purified and sequenced with the Big-Dye Terminator Kit (Applied Biosystems, Foster City, California, USA) using primers TtHFE F2 and TtHFE R2, and analyzed on an ABI 3130 automated DNA sequencer (Applied Biosystems) at the University of Florida Interdisciplinary Center for Biotechnology Research. Samples determined to be dolphin hfe were submitted for internal sequencing using the primers TtHFE F5 (5′ CTTTCCCCACAAGGAGTCTG) and TtHFE R5 (5′ CCAGAGCAAGGTAACGAAGC).

All nucleotide positions were sequenced twice in each direction to confirm their identity. Sequences were assembled using CLC Main Workbench version 5.5 (CLC Bio, Aarhus, Denmark). Each sample's hfe sequence was aligned and compared to examine for potential mutations or alternative splicing. The dolphin hfe nucleotide sequence was used to predict the protein amino acid sequence using the website ExPASY Bioinformatics Resource Portal (http://web.expasy.org/translate/). The predicted dolphin hfe amino acid sequence was analyzed for different protein motifs using InterProScan on the EMBL-EBI website (http://www.ebi.ac.uk/Tools/) (Quevillon et al. 2005).

The dolphin hfe mRNA was amplified by RT-PCR from seven samples (two cases, five controls). Six nucleotide differences were found within the samples evaluated (Table 2), four of which resulted in predicted amino acid changes. Four animals had different nucleotides in different clones, consistent with expression of both heterozygous genes from the parents. When case and control identities were revealed, no specific nucleotide differences segregated cases and controls. Four samples had evidence of alternative splicing. Four patterns of alternative splicing were seen (Fig. 1). First was the longest hfe nucleotide sequence, at 1,336 base pair (bp). Case 1 hfe mRNA clones did not contain exons 4 and 5; Case 2 had a truncated exon 4 and did not contain exon 6. Control 4 did not contain exon 4. Sequences were submitted to GenBank under accession numbers JX080683–JX080691.

Figure 1.

Diagram of alternate splicing seen in bottlenose dolphin (Tursiops truncatus) HFE mRNA clones.

Figure 1.

Diagram of alternate splicing seen in bottlenose dolphin (Tursiops truncatus) HFE mRNA clones.

Table 2.

Nucleotide differences between hfe genes from bottlenose dolphins (Tursiops trucatus).a

Nucleotide differences between hfe genes from bottlenose dolphins (Tursiops trucatus).a
Nucleotide differences between hfe genes from bottlenose dolphins (Tursiops trucatus).a

The dolphin HFE contains the conserved protein motifs for mammalian HFE proteins, including an MHC class I region with an alpha 1 and 2 regions and an immunoglobulin-like region. A BLASTP search of the translated full-length 1,336-bp sequence found that dolphin HFE amino acid sequence was most similar to bovine HFE (Bos taurus) (GenBank accession number AAW82001), consistent with their relationship in the Cetartiodactyla (Altschul et al. 1997). No specific point mutations differed between cases and controls. There were several samples that contained specific nucleotide differences from that of the dolphin hfe consensus sequence that we identified in the reference genome.

Analysis of the dolphin hfe sequences revealed evidence of alternative splicing. Four splice variants were identified but did not directly correspond to case versus control samples. It is not possible to state whether the alternate splicing seen in the cases was causal for, resultant from, or unrelated to iron storage disease in these animals. The human hfe gene undergoes alternative splicing (Thénié et al. 2000). Seven alternative transcripts in addition to the hfe wild type are expressed by various human tissues, particularly the liver and duodenum. These alternative transcripts contain exon deletions and intron insertions and are suggested to result in different functional proteins (Martins et al. 2011). Thus the alternative splicing in our samples may represent a normal process within the dolphin liver.

Although the hfe gene is of interest to determine its relationship to the clinical cases of hemochromatosis discussed in this study, there are several causes of hemochromatosis in mammalian species. Humans with the C282Y homozygote genotype do not always develop clinical signs for hemochromatosis or abnormal iron levels (Rochette et al. 2010). Hereditary hemochromatosis displays incomplete penetrance, in that people who are autosomal recessive for this genetic mutation do not always develop the clinical disease. Serum ferritin levels, hepatic function, age, sex, alcohol consumption, and hepatitis C can all affect the development of the clinical syndrome (Rochette et al. 2010). Managed-collection bottlenose dolphins have significantly higher iron levels than free-ranging dolphins, indicating that environmental, dietary, and metabolic factors likely play significant roles in disease development (Mazzaro et al. 2012; Venn-Watson et al. 2013).

Iron homeostasis is regulated by a number of proteins in addition to HFE. Mutations in the genes that regulate these proteins have been implicated in other types of human hereditary hemochromatosis (Pietrangelo 2010). These include HJV, TfR2, and the HAMP gene, which encodes for hepcidin (Rochette et al. 2010). To further characterize genetic causes for hemochromatosis in bottlenose dolphins, the role of these genes should be evaluated.

Studies have demonstrated an association between serum ferritin elevations and insulin resistance (Wrede et al. 2006; Davis et al. 2008). Individuals diagnosed with type 2 diabetes have persistent elevations in serum ferritin, an indicator of iron overload. Bottlenose dolphins have a diabetes-like metabolism, including a sustained postprandial hyperglycemia (Venn-Watson et al. 2007). Subsequent studies have demonstrated an association between elevated insulin levels and elevated serum iron and hemochromatosis in dolphins (Venn-Watson et al. 2011, 2013). Further studies are needed to assess potential parallels between insulin resistance-associated hemochromatosis in dolphins and humans.

In conclusion, although no specific nucleotide differences were determined in the hfe gene between affected and unaffected bottlenose dolphin samples, evidence of alternative splicing and nucleotide differences were found. Further research is warranted to completely characterize the alternative splicing of the dolphin hfe gene within hepatic tissue and evaluate for a potential genetic cause for hemochromatosis in this species.

ACKNOWLEDGMENTS

This work was funded by research grants N00014-06-1-0250 and N00014-09-1-0252 from the Office of Naval Research to H.H.N. and J.F.X.W. This project was supported by the Merck Merial Summer Research Program. We thank Heather Daniel Maness, Rebecca Rivera, Kevin Carlin, and Risa Daniels for their assistance.

LITERATURE CITED

LITERATURE CITED
Altschul
SF
,
Madden
TL
,
Schaffer
AA
,
Zhang
J
,
Zhang
Z
,
Miller
W
,
Lipman
DJ
.
1997
.
Gapped BLAST and PSI-BLAST: A new generation of protein database search programs
.
Nucleic Acids Res
25
:
3389
3402
.
Camaschella
C
,
Strati
P
.
2010
.
Recent advances in iron metabolism and related disorders
.
Intern Emerg Med
5
:
393
400
.
Clauss
M
,
Paglia
DE
.
2012
.
Iron storage disease disorders in captive wild mammals: The comparative evidence
.
J Zoo Wildl Med
43
(
3 Suppl
):
S6
S18
.
Davis
TME
,
Beilby
J
,
Davis
WA
,
Olynyk
JK
,
Jeffrey
GP
,
Rossi
E
,
Boyder
C
,
Bruce
DG
.
2008
.
Prevalence, characteristics, and prognostic significance of hfe gene mutations in type 2 diabetes
.
Diabetes Care
31
:
1795
1801
.
Johnson
SP
,
Venn-Watson
SK
,
Cassle
SE
,
Smith
CR
,
Jenson
ED
,
Ridgway
SH
.
2009
.
Use of phlebotomy treatment in Atlantic bottlenose dolphins with iron overload
.
J Am Vet Med Assoc
235
:
194
200
.
Martins
R
,
Silva
B
,
Proença
D
,
Faustino
P
.
2011
.
Differential hfe gene expression is regulated by alternative splicing in human tissues
.
PLos One
6
:
e17542
.
Mazzaro
LM
,
Johnson
SP
,
Fair
PA
,
Bossart
G
,
Carlin
KP
,
Jensen
ED
,
Smith
CR
,
Andrews
GA
,
Chavey
PS
,
Venn-Watson
S
.
2012
.
Iron indices in bottlenose dolphins (Tursiops truncatus)
.
Comp Med
62
:
508
515
.
Pietrangelo
A
.
2010
.
Hereditary hemochromatosis: Pathogenesis, diagnosis, and treatment
.
Gastroenterology
139
:
393
408
.
Quevillon
E
,
Silventoinen
V
,
Pillai
S
,
Harte
N
,
Mulder
N
,
Apweiler
R
,
Lopez
R
.
2005
.
InterProScan: Protein domains identifier
.
Nucleic Acids Res
33
(
Web Server issue
):
W116
W120
.
Rochette
J
,
Gac
GL
,
Lassoued
K
,
Férec
C
,
Robson
KJ
.
2010
.
Factors influencing disease phenotype and penetrance in hfe haemochromatosis
.
Hum Genet
128
:
233
248
.
Thénié
A
,
Orhant
M
,
Gicquel
I
,
Fergelot
P
,
Le Gall
J-Y
,
David
V
,
Mosser
J
.
2000
.
The hfe gene undergoes alternative splicing process
.
Blood Cells Mol Dis
26
:
155
162
.
Venn-Watson
S
,
Jenson
ED
,
Ridgway
SH
.
2007
.
Effects of age and sex on clinicopathologic reference ranges in healthy managed Atlantic bottlenose dolphin population
.
J Am Vet Med Assoc
231
:
596
601
.
Venn-Watson
S
,
Smith
CR
,
Jenson
ED
.
2008
.
Assessment of increased serum aminotransferases in a managed Atlantic bottlenose dolphin (Tursiops truncatus) population
.
J Wildl Dis
44
:
318
330
.
Venn-Watson
S
,
Carlin
K
,
Ridgway
S
.
2011
.
Dolphins as animal models for type 2 diabetes: Sustained, post-prandial hyperglycemia and hyperinsulinemia
.
Gen Comp Endocrinol
170
:
193
199
.
Venn-Watson
S
,
Benham
C
,
Carlin
K
,
St. Leger
J
.
2012
.
Hemochromatosis and fatty disease: Building evidence for insulin resistance in bottlenose dolphins (Tursiops truncatus)
.
J Zoo Wildl Med
43(3 Suppl)
:
S35
S47
.
Venn-Watson
S
,
Smith
C
,
Stevenson
S
,
Parry
C
,
Daniels
R
,
Jensen
E
,
Cendejas
V
,
Balmer
B
,
Janech
M
,
Neely
BA
,
Wells
R
.
2013
.
Blood-based indicators of insulin resistance and metabolic syndrome in bottlenose dolphins (Tursiops truncatus)
.
Front Endocrinol (Lausanne)
4
:
136
.
Wrede
CE
,
Buettner
R
,
Bollheimer
LC
,
Scholmerich
J
,
Palitzsch
KD
,
Hellerbrand
C
.
2006
.
Association between serum ferritin and the insulin resistance syndrome in a representative population
.
Eur J Endocrinol
154
:
333
340
.