Toxoplasmatinae Parasites in Bats from Bahia State, Brazil

Toxoplasma gondii is a globally distributed protozoan parasite capable of infecting birds and mammals, including humans. Wild and domestic Felidae serve as definitive hosts for the parasite (Dubey and Jones 2008). Cases of T. gondii infection were reported decades ago in an insectivorous bat (Akinchina and Doby 1968) and in four omnivorous bats (Schmidt et al. 1969). The first confirmed isolation and genotyping of viable T. gondii organisms from bats occurred quite recently using tissues from asymptomatic Brazilian bats (Cabral et al. 2013). The routes of infection and the effects of T. gondii infection among bats remain unknown (Sun et al. 2013; Jiang et al. 2014). Seropositive animals were found in none of 204 hematophagous (vampire) bats (Zetun et al. 2009) and in 32.6% of several chiropteran species (Cabral et al. 2014). There is one report of Toxoplasma infection resulting in disease and death of chiropterans: two flying foxes of genus Pteropus (Sangster et al. 2012).

Neospora caninum is a coccidian protozoa phylogenetically related to T. gondii (Mugridge et al. 2000). It infects several species of mammals and birds and has some canid species as definitive hosts (Goodswen et al. 2013). There are no records of N. caninum infection in chiropterans.

The role of bats as hosts for other pathogens, mostly viruses, is well known (Carneiro et al. 2010; Savani et al. 2010). These animals have distinct social and feeding habits. They can move long distances searching for food and shelter, and they interact and disseminate pathogens among wild and urban environments (Confalonieri et al. 2014).

We investigated T. gondii and N. caninum infections in wild bats in the state of Bahia in northeastern Brazil. Bahia state has a country-like geographical range (567,295 km²) and a great diversity of wildlife, including bats, that have a close interaction with humans and domestic animals. We captured 97 bats in 2008–09 and 2014–15, in different seasons of the year. The animals were caught by trained professionals from the Bahia State Agency for Agriculture and Livestock Defence, and they belonged to seven species: Carollia brevicauda (n=10), Carollia perspicillata (n=47), Desmodus rotundus (n=36), Glossophaga soricina (n=1), Lonchorhina aurita (n=1), Molossus rufus (n=1), and Trachops cirrhosis (n=1). The animals were euthanized by isoflurane anesthesia; euthanized by cardiac puncture; and necropsied for the collection of central nervous system (CNS) samples from each animal, which included a mixture of brain and medulla oblongata. The samples collected in 2008–09 were obtained from a previous study of rabies virus (Carneiro et al. 2010). All samples were stored at −20 C until processing.

We extracted DNA (50–150 mg) from CNS samples by using a commercial extraction kit (Easy-DNA®, Invitrogen®, Carlsbad, California, USA). The PCRs for T. gondii and N. caninum were performed using the primers TOX4: CGCTGCAGGGAGGAAGACGAAAGTTG and TOX5: CGCTGCAGACACAGTGCATCTGGATT (Homan et al. 2000), and Np-6: CTCGCCAGTCAACCTACGTCTTCT and Np-21: CCCAGTGCGTCCAATCCTGTA (Yamage et al. 1996). The reactions were conducted in final volumes of 25 μL and the reagents' concentrations followed recommendations in Yamage et al. (1996) and Homan et al. (2000). The PCR for T. gondii was carried out as follows: 7 min at 94 C, 35 cycles of 1 min at 94 C, 1 min at 55 C, 1 min at 72 C, and a 10-min incubation at 72 C. The PCR for N. caninum consisted of 2 min at 94 C, 35 cycles of 1 min at 94 C, 1 min at 55 C, 1 min at 72 C, and a final extension of 1 min at 72 C. Positive controls were DNA from tachyzoites of T. gondii (RH strain) and from N. caninum (NC-Bahia strain). Ultrapure water was used as a negative control for the DNA extraction and the DNA amplification reactions. The PCR products were stained with SYBR Gold (Invitrogen) and analyzed on 1.5% agarose gels under ultraviolet light.

The Fisher's exact test was used, with significance level of P<0.05, to compare the prevalence between vampire bats and nonblood sucking species, and between sexes. All animal procedures were approved by the Animal Ethics Committee from the School of Veterinary Medicine, Universidade Federal da Bahia, Brazil (protocols 15/2013 and 32/2014).

Two of 97 samples (2%) were positive for T. gondii DNA in bats from C. perspicillata. The two animals were captured in artificial shelters (culverts) in the city of Conceição do Jacuípe (12°19′S, 38°46′W). The small amount of amplified DNA was insufficient for genotyping by using restriction fragment length polymorphism.

There was a higher positive rate for T. gondii in other bats (2/61), compared to hematophagous bats (Desmodus rotundus; 0/36). However, there was no significant difference between the two groups (P=0.53). There was no difference in positivity (P=0.29) between males and females (Table 1), as a male and a female were positive. The number of males (n=79) was much higher than females (n=15) because the strategy to control vampire bats relies on applying the anticoagulant warfarin in a gel primarily to females, thereby reducing the availability of females for our study.

The distribution of T. gondii in tissues of infected chiropterans is not well known, but there may be a tropism for tissues such as brain, skeletal muscle, heart, spleen, liver, and lungs (Sangster et al. 2012; Fournier et al. 2014). Mice and rats that were experimentally infected with T. gondii developed higher numbers of tissue cysts in their brains compared with 10 other tissues (Dubey 1997). Because of the difficulty in obtaining tissue samples from chiropterans as a result of wildlife protection laws (Dodd et al. 2014) and the priority of using chiropteran tissues for rabies virus diagnosis in some regions (Carneiro et al. 2010), most studies have been performed with a variety of tissues other than the CNS (Sun et al. 2013; Jiang et al. 2014; Qin et al. 2014).

The reported prevalence of T. gondii infection in bats ranges from 0.54% (Cabral et al. 2013) to 29.3% (Sun et al. 2013). In our study, the observed frequency of T. gondii infection was 2% with CNS samples. Heart and pectoral muscle tissues from 369 bats were used in a study in southeastern Brazil, and only two animals were positive for the parasite (Cabral et al. 2013). Besides the high tropism of T. gondii for brain tissues in other animal species, brain and muscle of bats seem to be useful for T. gondii investigations in bats. Even a low prevalence of infection may represent a significant risk for dissemination of the parasite among other animal species due to the high number of bats that are present in urban and rural environments in Brazil.

The Carollia genus encompasses four species that occur in Brazil, making them among the most abundant bats in tropical America. Their diet is mainly fruits and insects, and they are well adapted to urban environments (Reis et al. 2007). Such proximity to humans and domestic animals favors the exposure of Carollia bats to the environmentally resistant oocysts of T. gondii and N. caninum, shed in feces of felids and canids, respectively. The bats may be exposed to oocysts present in insects, plants, and water sources (Smith and Frenkel 1978; Lass et al. 2012), which might explain the T. gondii infection of nonhematophagous bats in our study.

None of the samples from the tested bats was positive for N. caninum. However, due to the ability of this protozoan to infect various mammal species (Dubey 2003), the possibility of N. caninum infection in bats cannot be ruled out. As yet, there are no reports of infection of chiropterans by N. caninum.

The relatively small number of samples analyzed in our study and the examination of only CNS tissues may have contributed to the low prevalence of T. gondii detected and to the absence of positive animals for N. caninum. Because only tissues from the animals were available, serology could not be performed, and serology would have provided data on the exposure of bats to both parasites.

This study was partially supported by Fundação de Amparo à Pesquisa do Estado da Bahia. We thank the Bahia State Agency for Agriculture and Livestock Defence for excellent technical assistance. R.F.d.J. was recipient of a fellowship from Coordination for Improvement of Higher Education Personnel, and L.F.P.G. was granted a productivity scholarship by National Council for Scientific and Technological Development.