Abstract: 

Mycoplasma spp. are known from several chelonian and other reptilian species. We determined if turtles obtained by the Turtle Rescue Team at North Carolina State University are carriers of hemotropic Mycoplasma or Bartonella spp. Spleen samples were collected at necropsy during May through July, 2014 from 53 turtles of seven species. All turtles were dead or were euthanized upon arrival due to severe traumatic injuries, or they died shortly after beginning treatment. We used PCR amplification for both bacterial genera; Bartonella spp. DNA was not amplified. Based upon sequencing of the 16S rRNA subunit, one eastern box turtle (Terrapene carolina carolina) and one yellow-bellied slider (Trachemys scripta scripta) were infected with Mycoplasma spp. that have genetic similarities to strains that infect other animals.

Identification of vector-borne diseases in reptiles has largely been unexplored. Our project was inspired by the documentation of Bartonella spp. in sea turtles in North Carolina, US (Valentine et al. 2007), because subsequent investigations of reptiles, including terrestrial turtles, as a possible reservoir host remained lacking. Various Bartonella spp. have been identified in North Carolina cetaceans (Harms et al. 2008; Maggi et al. 2008) and river otters (Chinnadurai et al. 2010). Also, known and novel Mycoplasma spp. have been documented in reptiles, the majority of which are associated with clinical signs involving the respiratory tract (Brown et al. 2001; Feldman et al. 2006; Ossiboff et al. 2015). Hemotropic mycoplasmas (hemoplasmas) are small, epicellular, cell wall-deficient bacteria encountered in the blood of a variety of animal species that can contribute to pathogenic outcomes such as anemia, ill-thrift, and infertility (Messick 2004). Although it has been determined that hemoplasmas share phenotypic and genetic similarities with other Mycoplasma spp., variability in the genomes of these bacteria continue to complicate exact classification at the species level (Guimaraes et al. 2014). Different hemoplasma species are zoonotic and cause the same effects on red blood cells in human patients as they do in other mammals (Sykes et al. 2010; Steer et al. 2011). Clinical signs and pathogenic properties (if any) associated with hemoplasmas in reptiles are unknown.

The North Carolina State University College of Veterinary Medicine Turtle Rescue Team is a student-run organization of volunteers who rehabilitate wild reptiles (Lewbart et al. 2005). Between May and July 2014, samples of 53 spleens were collected from turtles admitted to the Turtle Rescue Team that either died or were euthanized, mostly due to trauma (mainly vehicular). The 53 specimens included 23 eastern box turtles (Terrapene carolina carolina), 14 yellow-bellied sliders (Trachemys scripta scripta), six river cooters (Pseudemys concinna), five eastern painted turtles (Chrysemys picta), three common snapping turtles (Chelydra serpentina), one common mud turtle (Kinosternon subrubrum), and one common musk turtle (Sternotherus odoratus). Turtles originated from central North Carolina. After death, specimens were stored at 4 C for up to 2 d until tissue harvest. We performed necropsies with the guidance of a sea turtle necropsy manual (Work 2000) using appropriate modifications made for each species. If DNA extraction could not be performed immediately, spleen specimens (up to 5 g, depending on the size of turtle) were harvested and stored frozen at 0 C in 5 mL screw-cap centrifuge tubes.

Spleen specimens were thawed or cut directly after necropsy into small pieces using a scalpel blade. Pathogen DNA extraction was performed with a standardized kit (DNeasy Blood & Tissue Kit, Qiagen, Valencia, California, USA), following the manufacturer's instructions for DNA extraction from tissues. Pathogen DNA concentrations and absorbance ratios at 260 nm and 280 nm were determined using the Nanodrop® ND-1000 (Thermo, Wilmington, Delaware, USA) to assess the concentration and purity of the DNA samples collected. Repeated DNA extractions were performed in eight cases to ensure that yields were >15 ng/μL.

We used pathogen DNA amplification, through PCR, to detect the presence of Bartonella spp. and hemotropic Mycoplasma spp. DNA in each sample. We amplified hemotropic Mycoplasma by targeting a conserved region of the 16SrRNA using oligonucleotides HemMycop16S-322s: 5′ GCC CAT ATT CCT ACG GGA AGC AGC AGT 3′ and HemMyco16S-938as: 5′ CTC CAC CAC TTG TTC AGG TCC CCG TC 3′ as previously described (Maggi et al. 2013b). Detection of Bartonella DNA was performed by targeting the 16S–23S intergenic spacer region using oligonucleotides 325s (5′ CCTCAGATGATGATCCCAAGCCTTTTGGCG 3′) and 1000as (5′ CTGAGCTACGGCCCCTAAATCAGG 3′) as forward and reverse primers, respectively (Valentine et al. 2007). Amplification for each genus was performed in a 25 μL final volume reaction. The 25 μL reaction mix contained 12.5 μL of MyTaq™ Red Mix (Bioline, Taunton, Massachusetts, USA), 0.2 μL of 50 μM of each forward and reverse primer (IDT® DNA Technologies, Coralville, Iowa, USA), 7.3 μL of molecular grade water, and 5 μL (75–150 ng total) of template DNA. We prepared positive controls using either 5 μL Mycoplasma hematoparvum 16SrRNA or Bartonella henselae intergenic spacer plasmid vectors (pGEM-T Easy Vector Systems, Promega, Madison, Wisconsin, USA) at a final concentration of five copies per microliter, for both Mycoplasma and Bartonella detection. Amplifications were performed in an Eppendorf Mastercycler EPgradient S® (Eppendorf, Hauppauge, New York, USA).

We used 2% agarose gel electrophoresis to analyze PCR products, with detection using ethidium bromide under ultraviolet light. Bartonella spp. DNA was not amplified from any turtle spleen. Two turtle spleens contained Mycoplasma spp. DNA. Amplicon products were sequenced by Genewiz (Research Triangle Park, North Carolina, USA) to establish species strain identification using chromatogram and alignment analysis (ContigExpress® and AlignX software, Vector NTI® v10, Invitrogen, Carlsbad, California, USA). After sequencing, phylogenetic and taxonomic comparisons were made using GenBank. The DNA sequence from the eastern box turtle number 24 (GenBank accession no. MG649987) was most similar to the following Mycoplasma sequences: 87% (490/564 base pairs [bp]) similar to Mycoplasmataceae bacterium T2110 (GenBank: DQ318957.1), an unclassified mycoplasma found in Atlantic Cod (Gadus morhua); 87% (484/557 bp) similar to Candidatus Mycoplasma haemohominis, found in humans; and 86% (483/564 bp) similar to Candidatus Mycoplasma haemominutum, found in cats (Fig. 1). The DNA sequence from yellow-bellied slider number 47 (GenBank: MG519832) was most similar to the following Mycoplasma sequences: 92% (514/557 bp) similar to Mycoplasma insons, previously found in green iguanas (Iguana iguana); 92% (514/557 bp) similar to Mycoplasma cavipharyngis, found in guinea pigs (Cavia porcellus); 92% (512/557 bp) similar to Mycoplasma fastidiosum, found in equines (Fig. 2).

Figure 1

Sequencing results highlighting the similarities between the Mycoplasma spp. identified in turtle number 24 (eastern box turtle, Terrapene carolina carolina) and turtle number 47 (yellow-bellied slider, Trachemys scripta scripta) to each other as well as to species of Mycoplasma found in canines and felines.

Figure 1

Sequencing results highlighting the similarities between the Mycoplasma spp. identified in turtle number 24 (eastern box turtle, Terrapene carolina carolina) and turtle number 47 (yellow-bellied slider, Trachemys scripta scripta) to each other as well as to species of Mycoplasma found in canines and felines.

Figure 2

The relationship between the novel Mycoplasma species in turtle number 24 (eastern box turtle, Terrapene carolina carolina) and turtle number 47 (yellow-bellied slider, Trachemys scripta scripta) to each other and to known Mycoplasma spp. using the 550 base pair region of 16S ribosomal RNA gene.

Figure 2

The relationship between the novel Mycoplasma species in turtle number 24 (eastern box turtle, Terrapene carolina carolina) and turtle number 47 (yellow-bellied slider, Trachemys scripta scripta) to each other and to known Mycoplasma spp. using the 550 base pair region of 16S ribosomal RNA gene.

Hemotropic Mycoplasma spp. have not previously been amplified from a reptile. The potential clinical impact that hemotropic Mycoplasma spp. have on reptiles is unknown because their pathogenicity in reptile species remains undetermined. Many turtles enter a rehabilitation facility already in compromised health, and stresses associated with trauma and rehabilitation can exacerbate what would otherwise be nonclinical or minor health issues. If hemotrophic Mycoplasma spp. are normally nonpathogenic in chelonian species, hemoplasmosis could have a negative impact on an animal's recovery and chance for ultimate release for those animals in rehabilitation facilities where concurrent diseases can exacerbate nonpathogenic conditions.

We do not know if the Mycoplasma spp. in chelonians are contagious to humans or to other animal species. Hemotrophic Mycoplasma spp. amplified from reservoir hosts, including foxes (Vulpes lagopus; Mascarelli et al. 2015), deer (Odocoileus virginianus; Maggi et al. 2013a), raccoon (Procyon lotor; Frerichs and Holbrook 1971), rodents (Elko and Cantrell 1968), and other animals (Messick 2004), might serve as sources for human infections. Zoonotic diseases such as Salmonella spp. and Eastern Equine Encephalitis virus have occurred following contact with nonclinical reptiles (White et al. 2011; Middleton et al. 2014). We used splenic extracts in our analyses and presumed that the Mycoplasma spp. was present in erythrocytes and not in splenic stroma.

Although we did not amplify DNA from a Bartonella spp. from terrestrial turtles in this study, a negative PCR result does not rule out a potential Bartonella spp. infection. In nonreservoir hosts, Bartonella spp. are most often found in very low concentrations in blood and splenic tissues, which could result in false negative PCR amplification. The role, if any, which reptiles play in transmission of Mycoplasma is unknown, and further investigation into hemotropic Mycoplasma and other blood pathogens is necessary. Our study provided additional information supporting the presence in reptiles of hemotropic Mycoplasmas, which were genetically very similar to pathogenic strains found in humans and other mammals. Until further investigation has evaluated the pathogenicity and spread of hemotropic Mycoplasma in reptiles, isolation of turtles with compromised health status, maintaining cleanliness and sterility of surgical and medical rehabilitation supplies or use of separate supplies for infected turtles, and having personal protective equipment for individuals handling potentially infected turtles might be indicated.

We thank the Robert J. Koller Aquatic Animal Medicine Research Endowment for financial support and the Turtle Rescue Team students who assisted in the procurement of specimens and samples.

LITERATURE CITED

LITERATURE CITED
Brown
MB,
Brown
DR,
Klein
PA,
McLaughlin
GS,
Schumacher
IM,
Jacobson
ER,
Adams
HP,
Tully
JG.
2001
.
Mycoplasma agassizii sp. nov., isolated from the upper respiratory tract of the desert tortoise (Gopherus agassizii) and the gopher tortoise (Gopherus polyphemus)
.
Int J Syst Evol Microbiol
51
:
413
418
.
Chinnadurai
SK,
Birkenheuer
AJ,
Blanton
HL,
Maggi
RG,
Belfiore
N,
Marr
HS,
Breitschwerdt
EB,
Stoskopf
MK.
2010
.
Prevalence of selected vector-borne organisms and identification of Bartonella species DNA in North American river otters (Lontra canadensis)
.
J Wildl Dis
46
:
947
950
.
Elko
EE,
Cantrell
W.
1968
.
Phagocytosis and anemia in rats infected with Haemobartonella muris
.
J Infect Dis
118
:
324
332
.
Feldman
SH,
Wimsatt
J,
Marchang
RE,
Johnson
AJ,
Brown
W,
Mitchell
JC,
Sleeman
JM.
2006
.
A novel Mycoplasma detected in association with upper respiratory disease syndrome in free-ranging eastern box turtles (Terrapene carolina carolina) in Virginia
.
J Wildl Dis
42
:
279
289
.
Frerichs
WM,
Holbrook
AA.
1971
.
Haemobartonella procyoni sp. n. in the raccoon, Procyon lotor
.
J Parasitol
57
:
1309
1310
.
Guimaraes
AS,
Santos
AP,
do Nascimento
NC,
Timenetsky
J,
Messick
JB.
2014
.
Comparative genomics and phylogenomics of hemotrophic mycoplasmas
.
PLoS One
9
:
e91445
.
Harms
CA,
Maggi
RG,
Breitschwerdt
EB,
Clemons-Chevis
CL,
Solangi
M,
Rotstein
DS,
Fair
PA,
Hansen
LJ,
Hohn
AA,
Lovewell
GN,
et al.
2008
.
Bartonella species detection in captive, stranded and free ranging cetaceans
.
Vet Res
39
:
59
.
Lewbart
GA,
Kishimori
J,
Christian
LS.
2005
.
The North Carolina State University College of Veterinary Medicine Turtle Rescue Team: A model for a successful wild-reptile clinic
.
J Vet Med Educ
32
:
377
381
.
Maggi
RG,
Chitwood
MC,
Kennedy-Stoskopf
SK,
DePerno
CS.
2013
a
.
Novel hemotropic Mycoplasma species in white-tailed deer (Odocoileus virginianus)
.
Comp Immunol Microbiol Infect Dis
36
:
607
611
.
Maggi
RG,
Compton
SM,
Trull
CL,
Mascarelli
PE,
Mozayeni
BR,
Breitschwerdt
EB.
2013
b
.
Infection with hemotropic Mycoplasma species in patients with or without extensive arthropod or animal contact
.
J Clin Microbiol
51
:
3237
3241
.
Maggi
RG,
Raverty
SA,
Lester
SJ,
Huff
DG,
Haulena
M,
Ford
SL,
Nielsen
O,
Robinson
JH,
Breitschwerdt
EB.
2008
.
Bartonella henselae in captive and hunter-harvested beluga (Delphinapterus leucas)
.
J Wildl Dis
44
:
871
877
.
Mascarelli
PE,
Elmore
SA,
Jenkins
EJ,
Alisauskas
RT,
Walsh
M,
Breitschwerdt
EB,
Maggi
RG.
2015
.
Vector-borne pathogens in arctic foxes, Vulpes lagopus, from Canada
.
Res Vet Sci
99
:
58
59
.
Messick
JB.
2004
.
Hemotrophic mycoplasmas (hemoplasmas): A review and new insights into pathogenic potential
.
Vet Clin Pathol
33
:
2
13
.
Middleton
DM,
La Flamme
AC,
Gartrell
BD,
Nelson
NJ.
2014
.
Reptile reservoirs and seasonal variation in the environmental presence of salmonella in an island ecosystem, Stephens Island, New Zealand
.
J Wildl Dis
50
:
655
659
.
Ossiboff
RJ,
Raphael
BL,
Ammazzalorso
AD,
Seimon
TA,
Niederriter
H,
Zarate
B,
Newton
AL,
McAloose
D.
2015
.
A Mycoplasma species of Emydidae turtles in the northeastern USA
.
J Wildl Dis
51
:
466
470
.
Steer
JA,
Tasker
S,
Barker
EN,
Jensen
J,
Mitchell
J,
Stocki
T,
Chalker
VJ,
Hamon
M.
2011
.
A novel hemotropic Mycoplasma (Hemoplasma) in a patient with hemolytic anemia and pyrexia
.
Clin Infect Dis
53
:
e147
e151
.
Sykes
JE,
Lindsay
LL,
Maggi
RG,
Breitschwerdt
EB.
2010
.
Human coinfection with Bartonella henselae and two hemotropic mycoplasma variants resembling Mycoplasma ovis
.
J Clin Microbiol
48
:
3782
3785
.
Valentine
KH,
Harms
CA,
Cadenas
MB,
Birkenheuer
AJ,
Marr
HS,
Braun-McNeill
J,
Maggi
RG,
Breitschwerdt
EB.
2007
.
Bartonella DNA in loggerhead sea turtles
.
Emerg Infect Dis
13
:
949
950
.
White
G,
Ottendorfer
C,
Graham
S,
Unnasch
TR.
2011
.
Competency of reptiles and amphibians for eastern equine encephalitis virus
.
Am J Trop Med Hyg
85
:
421
425
.
Work
TM.
2000
.
Sea turtle necropsy manual for biologists in remote refuges
. .