Trypanosoma cruzi Survey in Poached Pichis (Zaedyus pichiy; Mammalia, Cingulata) from Mendoza, Argentina

Trypanosoma cruzi (Kinetoplastida: Trypanosomatidae) is the causative agent of Chagas disease, one of the most important human neglected vector-borne diseases (Molyneux et al. 2017). The transmission cycles of this blood parasite involve a wide variety of mammals and hematophagous triatomine insect species in the Americas (Georgieva et al. 2017). Research on T. cruzi infection in armadillos (Mammalia: Cingulata) started in 1912 when Carlos Chagas described the parasite in a wild nine-banded armadillo (Dasypus novemcinctus; Chagas 1912). Since then, several studies have reported T. cruzi infection in various armadillo species (e.g., Roque et al. 2008; Acosta and López 2013; Orozco et al. 2013). The first report of T. cruzi infection in Zaedyus pichiy, a small, diurnal armadillo that inhabits xeric shrublands and grasslands of central and southern Argentina and Chile, occurred in Mendoza Province in central-western Argentina (Mazza and Miyara 1935). More recently, Superina et al. (2009) detected 2 seropositive out of 25 Z. pichiy in the same province. Mendoza Province is categorized as having a high risk for vector transmission of Chagas disease (Danesi et al. 2019). The hematophagous triatomine species Triatoma infestans, T. garciabesi, T. guasayana, T. eratyrusiformis, T. patagonica, T. platensis all occur in Mendoza Province (Ceccarelli et al. 2020), but their relevance in the sylvatic transmission cycle in our study area is unknown. Zaedyus pichiy digs deep burrows for shelter and thermoregulation (Superina and Abba 2014; Rodrigues et al. 2020). This trait, as well as its omnivorous food habits, may favor contact with triatomine vectors (Jansen et al. 2017).

Pichis are frequently hunted and consumed throughout their range (Superina 2008). The use of tissue samples from armadillos that have been confiscated dead from hunters is an ethically justifiable way to perform population studies (Superina et al. 2009) and could be useful to monitor the presence of T. cruzi in the sylvatic transmission cycle. However, it is often difficult to obtain complete and fresh carcasses because of the interval between the time of death and confiscation and sampling (Superina et al. 2009), which reduces the possibilities of analyzing blood or serum samples or of performing histological studies. The use of molecular techniques allows detecting the parasite with high sensitivity (Yefi-Quinteros et al. 2018), even in samples of suboptimal quality. The objective of our study was to determine the presence and parasite load of T. cruzi in confiscated Z. pichiy from an endemic area. In addition, we were interested in establishing associations between age, sex, and origin (ecoregion) of the individuals.

Samples were collected from 49 Z. pichiy (23 females, 26 males) that had been confiscated dead from poachers during road controls in two different areas of Mendoza Province, Argentina, 2010–2017. All animals had been caught in the wild by poachers no more than 24 h before their confiscation. There were 36 adults and 13 juveniles; age determination followed Actis et al. (2017). Seventeen came from the Patagonian steppe ecoregion in southern Mendoza Province (36°35′S, 68°32′W); 29 had been poached in the hotter and drier Chacoan monte desert in north-eastern Mendoza Province (32°34′S, 68°16′W). Necropsies were performed on all animals. Because poachers usually kill and eviscerate the pichis shortly after capturing them, it was not possible to collect spleen or liver tissue from all individuals. The heart was one of the few organs we could obtain from all confiscated individuals; therefore we focused on cardiac muscle tissue. Hearts were extracted and dissected to obtain a sample of approximately 4×4×4 mm of the apex, which was stored at –80 C until DNA extraction.

We extracted DNA from 25 mg of heart tissue using the UltraClean^® Tissue & Cells DNA Isolation Kit (MO BIO, Carlsbad, California, USA). The standard protocol was modified as follows: 50 pg of internal amplification control (IAC; 183 pb from Arabidopsis thaliana, GenBank accession number NM_114612) was incorporated during the binding step to detect carryover of PCR inhibitors and loss of DNA in the process (Duffy et al. 2009; Mc Cabe et al. 2019). Real-time PCR assays were performed using T. cruzi nuclear satellite DNA primers Cruzi 1 (ASTCGGCTGATCGTTTTCGA) and Cruzi 2 (AATTCCTCCAAGCAGCGGATA) (Piron et al. 2007). Assays were performed in a Rotor-Gene^® Q (Qiagen, Germantown, Maryland, USA). The cycling conditions were as follows: a preincubation for 15 min at 95 C, followed by 40 cycles at 95 C for 15 s, 60 C for 20 s, and 72 C for 20 s. After all the amplification cycles, a melting curve was run. Each sample was tested in duplicate and each assay included a no-template control (nuclease-free water), a positive control (20 fg/µL of genomic DNA from T. cruzi Y and DM28c strains), and negative control (DNA from an uninfected juvenile pichi born at our breeding facility). Positive samples were confirmed with melting temperature in a range of 83.8–85.8 C; cross-reactions with other pathogens are unlikely with satellite region amplification (Ramírez et al. 2015).

The standard curve for absolute quantification was made with equal quantities of the clonal reference strains Dm28c (TcI) and Y (TcII) to reduce the differences in the detection limits, given the previously described variability in the number of copies of the nuclear satellite DNA (Duffy et al. 2009). The standard calibration curve for the IAC, qPCR reagents, and cycling conditions were the same as described in Mc Cabe et al. (2019).

Parasite loads in the positive samples were calculated using the standard curve, spiked with a mixture of strains (efficiency=1.02; R²=0.99; dynamic range=0.1–10⁵ par-eq/mL) and normalized by IAC recovery. Because DNA was extracted from 25 mg of heart samples and the concentrations were low, the number of parasite-equivalents (par-eq) per mg of tissue was calculated. Due to the low concentrations, results are expressed as par-eq/µg. Pearson chi-square tests were used to compare frequencies of infection and median tests to compare parasite loads of positive individuals between different age groups, females and males, and the two geographical areas. Statistical analyses were performed using SPSS version 25 (IBM Corp. 2017); results were considered significant at P<0.05.

Trypanosoma cruzi DNA was detected in 32/49 (65%) heart samples. No significant differences were found in the frequency of infection between males and females, adults and juveniles, or ecoregions (P>0.05 in all cases; Table 1).

Parasite loads ranged between <0.1 and 8.88 par-eq/µg (median±SD 1.66±2.24; Table 1). Comparison of the median parasite load did not reveal any significant differences among age classes, sex, or ecoregions (P>0.05).

Because of the method's sensitivity limit, the quantity of parasitic DNA in the samples was insufficient to identify the infective discrete typing unit (Muñoz-San Martín et al. 2017). The low parasite loads may be related to the fact that we analyzed samples from the cardiac apex, as parasite distribution might not be uniform throughout the heart tissue (James et al. 2002). It is also possible that our analyses detected T. cruzi parasites circulating in the cardiac blood vessels rather than myocardial tropism. Two previous studies found armadillos positive for T. cruzi in blood cultures or serological analyses, but without histopathological lesions or amastigote nests (Barr et al. 1991; Superina et al. 2009).

In contrast to previous serological studies that identified evidence of exposure but not active infection (Superina et al. 2009), our approach of direct parasite detection in Z. pichiy heart samples confirms infection with T. cruzi in a high proportion of confiscated armadillos. The higher proportion of animals found positive in our study, 65%, versus the 8% reported by Superina et al. (2009), is probably related to the difference in sensitivity of the methods used. Superina et al. (2009) used a commercial test kit based on indirect hemagglutination (IHA). Other studies have reported a low sensitivity of IHA compared to other serological techniques (Lauricella et al. 1998), which also varied between species (Enriquez et al. 2013). Furthermore, PCR has been shown to be more sensitive for detecting T. cruzi infection in the chronic phase of infection than serological analyses (Torcoroma-García et al. 2021), with quantitative PCR being more effective to detect low parasite burdens, especially in tissue samples (Davies et al. 2014).

It would be important to perform additional studies on the infection status of Z. pichiy to determine their role in the maintenance of the sylvatic transmission cycle. Considering that pichis are intensely sought after as a protein source, we also suggest assessment of the potential zoonotic risk associated with their hunting.

Permission to collect samples from confiscated pichis was granted by the Dirección de Recursos Naturales Renovables of Mendoza Province through Resolutions 794/09, 871/11, 823/13, and 105/16. We are thankful to the rangers and inspectors of Mendoza Province, especially Guillermo Ferraris, for their help with sample collection, and Esteban Yefi-Quinteros for his help in the molecular laboratory. Financial support was provided by PICT 2014-0496, Fundación Bunge y Born, and Proyecto ANID-FONDECYT 3170799 and 1180940.

© Wildlife Disease Association 2023